Transcript: Mouse XM_006536229.1

PREDICTED: Mus musculus ribosomal protein, large P2 (Rplp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rplp2 (67186)
Length:
616
CDS:
227..574

Additional Resources:

NCBI RefSeq record:
XM_006536229.1
NBCI Gene record:
Rplp2 (67186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006536229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104125 AGCGCCAAAGACATCAAGAAA pLKO.1 281 CDS 100% 5.625 2.813 Y Rplp2 n/a
2 TRCN0000316939 AGCGCCAAAGACATCAAGAAA pLKO_005 281 CDS 100% 5.625 2.813 Y Rplp2 n/a
3 TRCN0000419506 AGAGGAGAAGAAAGATGAGAA pLKO_005 499 CDS 100% 4.950 2.475 Y RPLP2 n/a
4 TRCN0000104127 GTGAGCTGAATGGAAAGAACA pLKO.1 357 CDS 100% 4.950 2.475 Y Rplp2 n/a
5 TRCN0000317014 GTGAGCTGAATGGAAAGAACA pLKO_005 357 CDS 100% 4.950 2.475 Y Rplp2 n/a
6 TRCN0000104126 TGATCGGCTCAACAAGGTCAT pLKO.1 334 CDS 100% 4.050 2.025 Y Rplp2 n/a
7 TRCN0000317016 TGATCGGCTCAACAAGGTCAT pLKO_005 334 CDS 100% 4.050 2.025 Y Rplp2 n/a
8 TRCN0000104128 GAAAGAACATTGAGGATGTCA pLKO.1 369 CDS 100% 3.000 1.500 Y Rplp2 n/a
9 TRCN0000317015 GAAAGAACATTGAGGATGTCA pLKO_005 369 CDS 100% 3.000 1.500 Y Rplp2 n/a
10 TRCN0000104129 GCTCAACAAGGTCATCAGTGA pLKO.1 340 CDS 100% 2.640 1.320 Y Rplp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006536229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01442 pDONR223 96.4% 89.8% 99.1% None (many diffs) n/a
2 ccsbBroad304_01442 pLX_304 0% 89.8% 99.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000466748 CGACCCGGGCCCTGACTTCGTGAG pLX_317 34.6% 89.8% 99.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000478702 TGACTCGCGTTGCAACCAATCGTG pLX_317 36.3% 89.8% 99.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV