Construct: ORF TRCN0000478766
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000092.2_s317c1
- Derived from:
- ccsbBroadEn_13192
- DNA Barcode:
- CAGTGCTTACCATATCTGGTCGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VPS37A (137492)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478766
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_001363168.1 | 56.6% | 56.6% | 1_399del |
| 2 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_001363169.1 | 56.6% | 56.6% | 1_399del |
| 3 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_001363170.1 | 54.7% | 54.7% | 1_399del;628_629insAGTATGAATTACTTACAC |
| 4 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_001363171.1 | 54.7% | 54.7% | 1_399del;628_629insAGTATGAATTACTTACAC |
| 5 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_001363172.2 | 54.7% | 54.7% | 1_399del;628_629insAGTATGAATTACTTACAC |
| 6 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_001145152.1 | 46.7% | 46.7% | 1_594del |
| 7 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_001363173.2 | 43.8% | 43.8% | 1_669del |
| 8 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_152415.3 | 43.8% | 43.8% | 1_669del |
| 9 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | XM_017013021.2 | 43.8% | 43.8% | 1_669del |
| 10 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | NM_001363167.1 | 42.3% | 42.3% | 1_669del;898_899insAGTATGAATTACTTACAC |
| 11 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | XR_002956599.1 | 14.1% | 1_28del;551_3690del | |
| 12 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | XR_002956595.1 | 11% | 1_987del;1217_1293del;1587_4726del | |
| 13 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | XR_002956598.1 | 11% | 1_987del;1160_1242del;1593_4732del | |
| 14 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | XR_002956594.1 | 10.9% | 1_936del;1165_1166insAGTATGAATTACTTACAC;1441_4580del | |
| 15 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | XR_002956597.1 | 10.8% | 1_978del;1207_1208insAGTATGAATTACTTACAC;1483_4622del | |
| 16 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | XR_002956596.1 | 10.7% | 1_1032del;1261_1262insAGTATGAATTACTTACAC;1537_4676del | |
| 17 | human | 137492 | VPS37A | VPS37A subunit of ESCRT-I | XR_002956593.1 | 7.7% | (many diffs) | |
| 18 | mouse | 52348 | Vps37a | vacuolar protein sorting 37A | XM_011242230.2 | 62.9% | 64.5% | (many diffs) |
| 19 | mouse | 52348 | Vps37a | vacuolar protein sorting 37A | NM_033560.3 | 39.7% | 40.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 588
- ORF length:
- 522
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc agatgtccct gatgcatttc cagaactctc agaactaagt gtgtcacaac 121 tcacagatat gaatgaacaa gaggaggtat tactagaaca gtttctgact ttgcctcaac 181 taaaacaaat tattaccgac aaagatgact tagtaaaaag tattgaggaa ctagcaagaa 241 aaaatctcct tttggagccc agcttggaag ccaaaagaca aactgtttta gataagtatg 301 aattacttac acagatgaag tccactttcG AAAAGAAGAT GCAAAGGCAG CATGAACTTA 361 GTGAGAGCTG TAGTGCAAGT GCCCTTCAGG CAAGATTGAA AGTAGCTGCA CATGAAGCTG 421 AGGAAGAATC TGATAATATT GCAGAAGACT TCTTGGAGGG AAAGATGGAA ATAGATGATT 481 TTCTCAGTAG CTTCATGGAA AAGAGAACAA TTTGCCACTG TAGAAGAGCC AAGGAAGAGA 541 AACTTCAGCA GGCGATAGCA ATGCACAGCC AATTTCATGC TCCACTATAC CCAACTTTCT 601 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 661 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 721 GTGGAAAGGA CGACAGTGCT TACCATATCT GGTCGGTACG CGTTAAGTCg acaatcaacc 781 tctggattac aaaatttgtg aaagatt