Transcript: Mouse NM_033560.3

Mus musculus vacuolar protein sorting 37A (Vps37a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Vps37a (52348)
Length:
6379
CDS:
327..1520

Additional Resources:

NCBI RefSeq record:
NM_033560.3
NBCI Gene record:
Vps37a (52348)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033560.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197475 CTCTCCATTAGTAAGCAATTT pLKO.1 623 CDS 100% 13.200 18.480 N Vps37a n/a
2 TRCN0000376021 ATGGATAGTCAAGGATTATAT pLKO_005 597 CDS 100% 15.000 12.000 N Vps37a n/a
3 TRCN0000376022 GGTTATAAGATGCCGGATATT pLKO_005 987 CDS 100% 13.200 10.560 N Vps37a n/a
4 TRCN0000279496 GCATGTAATTCTAGCTAATTT pLKO_005 1784 3UTR 100% 15.000 10.500 N Vps37a n/a
5 TRCN0000279497 ATAGCGATGCACAGCCAATTT pLKO_005 1485 CDS 100% 13.200 9.240 N Vps37a n/a
6 TRCN0000198514 GCTGAGGAAGAATCGGATAAT pLKO.1 1347 CDS 100% 13.200 9.240 N Vps37a n/a
7 TRCN0000279494 GCTGAGGAAGAATCGGATAAT pLKO_005 1347 CDS 100% 13.200 9.240 N Vps37a n/a
8 TRCN0000279495 TTCATGCTCCTCTCTAGATTT pLKO_005 1504 CDS 100% 13.200 9.240 N Vps37a n/a
9 TRCN0000177629 CCTGTATTTAAGTTCCTCTAT pLKO.1 1745 3UTR 100% 4.950 3.465 N Vps37a n/a
10 TRCN0000279434 CCTGTATTTAAGTTCCTCTAT pLKO_005 1745 3UTR 100% 4.950 3.465 N Vps37a n/a
11 TRCN0000197701 GAGGTATTACTAGAACAGTTT pLKO.1 1074 CDS 100% 4.950 3.465 N Vps37a n/a
12 TRCN0000200301 GAAGCTGAGGAAGAATCGGAT pLKO.1 1344 CDS 100% 2.640 1.848 N Vps37a n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1985 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033560.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13192 pDONR223 100% 39.7% 40.8% None (many diffs) n/a
2 ccsbBroad304_13192 pLX_304 0% 39.7% 40.8% V5 (many diffs) n/a
3 TRCN0000478766 CAGTGCTTACCATATCTGGTCGGT pLX_317 49.6% 39.7% 40.8% V5 (many diffs) n/a
Download CSV