Transcript: Human XR_002956596.1

PREDICTED: Homo sapiens VPS37A subunit of ESCRT-I (VPS37A), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS37A (137492)
Length:
4676
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956596.1
NBCI Gene record:
VPS37A (137492)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956596.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379537 AGATTGCCATTCACCATAAAC pLKO_005 520 3UTR 100% 13.200 18.480 N VPS37A n/a
2 TRCN0000380635 TTACCGACAAAGATGACTTAG pLKO_005 1160 3UTR 100% 10.800 8.640 N VPS37A n/a
3 TRCN0000073184 CCGACAAAGATGACTTAGTAA pLKO.1 1163 3UTR 100% 5.625 4.500 N VPS37A n/a
4 TRCN0000073187 ACCATAAACAACCTGACAATT pLKO.1 532 3UTR 100% 13.200 9.240 N VPS37A n/a
5 TRCN0000382141 CACCAATACGACATCACTTAA pLKO_005 614 3UTR 100% 13.200 9.240 N VPS37A n/a
6 TRCN0000073186 CGACATCACTTAATGGATAAA pLKO.1 622 3UTR 100% 13.200 9.240 N VPS37A n/a
7 TRCN0000379429 TAGCAATGCACAGCCAATTTC pLKO_005 1505 3UTR 100% 13.200 9.240 N VPS37A n/a
8 TRCN0000447000 AGTGCCCTTCAGGCAAGATTG pLKO_005 1327 3UTR 100% 10.800 7.560 N VPS37A n/a
9 TRCN0000197701 GAGGTATTACTAGAACAGTTT pLKO.1 1111 3UTR 100% 4.950 3.465 N Vps37a n/a
10 TRCN0000073185 GCCAATTTCATGCTCCACTAT pLKO.1 1517 3UTR 100% 4.950 3.465 N VPS37A n/a
11 TRCN0000073183 CCTGGAAACATGAACTGCCAA pLKO.1 1545 3UTR 100% 2.640 1.848 N VPS37A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956596.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13192 pDONR223 100% 10.7% None 1_1032del;1261_1262insAGTATGAATTACTTACAC;1537_4676del n/a
2 ccsbBroad304_13192 pLX_304 0% 10.7% V5 1_1032del;1261_1262insAGTATGAATTACTTACAC;1537_4676del n/a
3 TRCN0000478766 CAGTGCTTACCATATCTGGTCGGT pLX_317 49.6% 10.7% V5 1_1032del;1261_1262insAGTATGAATTACTTACAC;1537_4676del n/a
Download CSV