Construct: ORF TRCN0000478831
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002748.1_s317c1
- Derived from:
- ccsbBroadEn_02808
- DNA Barcode:
- TGCAGTGTCTATCATCAATGTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CORO1C (23603)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478831
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23603 | CORO1C | coronin 1C | NM_001276471.1 | 100% | 100% | |
| 2 | human | 23603 | CORO1C | coronin 1C | NM_014325.3 | 100% | 100% | |
| 3 | human | 23603 | CORO1C | coronin 1C | XM_017019122.2 | 100% | 100% | |
| 4 | human | 23603 | CORO1C | coronin 1C | XM_017019123.2 | 100% | 100% | |
| 5 | human | 23603 | CORO1C | coronin 1C | XM_024448914.1 | 100% | 100% | |
| 6 | human | 23603 | CORO1C | coronin 1C | XM_024448915.1 | 100% | 100% | |
| 7 | human | 23603 | CORO1C | coronin 1C | XM_024448916.1 | 100% | 100% | |
| 8 | human | 23603 | CORO1C | coronin 1C | NM_001105237.2 | 89.9% | 89.9% | 1_159del |
| 9 | human | 23603 | CORO1C | coronin 1C | XM_017019121.2 | 89.9% | 89.9% | 1_159del |
| 10 | human | 23603 | CORO1C | coronin 1C | XM_011538125.1 | 58.3% | 56.5% | (many diffs) |
| 11 | human | 23603 | CORO1C | coronin 1C | XM_024448917.1 | 57.1% | 55.4% | (many diffs) |
| 12 | human | 23603 | CORO1C | coronin 1C | XR_944514.2 | 37% | 1_95del;949_971del;1541_3837del | |
| 13 | human | 23603 | CORO1C | coronin 1C | XR_001748650.1 | 35.9% | 1_95del;949_1092del;1662_3958del | |
| 14 | human | 23603 | CORO1C | coronin 1C | XR_002957304.1 | 35.2% | 1_289del;1143_1165del;1735_4031del | |
| 15 | mouse | 23790 | Coro1c | coronin, actin binding prot... | NM_011779.3 | 88.5% | 97.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1488
- ORF length:
- 1422
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gcgagtggta cgacagagca agtttcggca tgtatttggg caagcggtga 121 aaaatgacca gtgctatgat gacatccggg tttctcgtgt gacctgggat agttcctttt 181 gtgctgtcaa tcccagattt gttgccataa tcatagaggc aagtggggga ggagcgttcc 241 ttgtcctccc tctgcacaag actggtcgaa ttgacaaatc ttaccctaca gtatgtggcc 301 acacaggacc agtgctggac atagactggt gcccacataa cgatcaggtc attgccagcg 361 gttcagagga ctgcacggtc atggtatggc agatcccaga aaatggactc accctttccc 421 tgactgaacc tgtggtgatt ttggaaggcc actcaaagag agtcggcatc gtggcttggc 481 atccaacggc ccgcaatgtg cttcttagtg caggctgtga taatgccatt atcatctgga 541 atgtgggaac aggggaagcc cttataaact tggacgatat gcattcagac atgatttaca 601 atgtgagctg gaaccggaat ggcagtctga tctgcacagc ttccaaagac aagaaagtga 661 gagtcattga tcccaggaaa caagagattg ttgctgagaa ggagaaagca catgaaggag 721 caagacccat gagagccatc ttcctggccg atggcaatgt cttcaccact gggttcagcc 781 gcatgagcga gcggcagctg gctctctgga atccgaaaaa tatgcaggaa ccaattgctc 841 ttcatgagat ggacactagc aatggggtgt tgctgccttt ctatgaccct gacaccagca 901 tcatttactt atgtggaaag ggtgacagca gtattcgcta ttttgagatc acggatgaat 961 ccccgtacgt ccactacctc aacacattca gcagcaagga gcctcagaga gggatgggtt 1021 acatgcccaa gaggggactt gatgttaaca aatgtgagat tgccagattc ttcaaacttc 1081 atgagagaaa gtgtgaacct attattatga ctgttcccag gaagtctgac cttttccaag 1141 atgacctgta tcctgacaca gcggggccag aggccgcgct ggaggcagaa gagtggttcg 1201 aaggcaagaa tgcagaccca aTCCTCATCT CCTTGAAGCA CGGGTACATT CCAGGCAAAA 1261 ACAGGGATCT CAAGGTGGTC AAGAAGAACA TTCTGGATAG CAAGCCCACT GCAAACAAGA 1321 AGTGCGACCT GATCAGCATC CCCAAGAAAA CCACAGACAC GGCCAGTGTG CAAAATGAAG 1381 CCAAGTTGGA TGAGATTTTA AAAGAGATCA AATCTATAAA AGACACAATC TGCAATCAAG 1441 ATGAGCGTAT TTCCAAGTTA GAACAGCAGA TGGCAAAGAT AGCAGCCTGC CCAACTTTCT 1501 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1561 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1621 GTGGAAAGGA CGATGCAGTG TCTATCATCA ATGTTTTACG CGTTAAGTCg acaatcaacc 1681 tctggattac aaaatttgtg aaagatt