Transcript: Human NM_001105237.2

Homo sapiens coronin 1C (CORO1C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CORO1C (23603)
Length:
3939
CDS:
50..1633

Additional Resources:

NCBI RefSeq record:
NM_001105237.2
NBCI Gene record:
CORO1C (23603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001105237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062773 GCAATCAAGATGAGCGTATTT pLKO.1 1575 CDS 100% 13.200 18.480 N CORO1C n/a
2 TRCN0000418103 GTGACAGCAGTATTCGCTATT pLKO_005 1065 CDS 100% 10.800 15.120 N CORO1C n/a
3 TRCN0000062774 CCACATAACGATCAGGTCATT pLKO.1 476 CDS 100% 4.950 6.930 N CORO1C n/a
4 TRCN0000062775 GCCCTTATAAACTTGGACGAT pLKO.1 701 CDS 100% 2.640 3.696 N CORO1C n/a
5 TRCN0000432164 TGCACAAGACTGGTCGAATTG pLKO_005 396 CDS 100% 10.800 7.560 N CORO1C n/a
6 TRCN0000062777 CGTCCACTACCTCAACACATT pLKO.1 1111 CDS 100% 4.950 3.465 N CORO1C n/a
7 TRCN0000062776 GCCAGATTCTTCAAACTTCAT pLKO.1 1205 CDS 100% 4.950 3.465 N CORO1C n/a
8 TRCN0000439769 TGTCGTGCCCAAGTACCCTTT pLKO_005 1967 3UTR 100% 4.050 2.835 N CORO1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02808 pDONR223 100% 89.9% 89.9% None 1_159del n/a
2 ccsbBroad304_02808 pLX_304 0% 89.9% 89.9% V5 1_159del n/a
3 TRCN0000478831 TGCAGTGTCTATCATCAATGTTTT pLX_317 19.2% 89.9% 89.9% V5 1_159del n/a
Download CSV