Transcript: Mouse NM_011779.3

Mus musculus coronin, actin binding protein 1C (Coro1c), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Coro1c (23790)
Length:
3436
CDS:
102..1526

Additional Resources:

NCBI RefSeq record:
NM_011779.3
NBCI Gene record:
Coro1c (23790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313282 TGACAGCAGTATCCGCTATTT pLKO_005 959 CDS 100% 13.200 18.480 N Coro1c n/a
2 TRCN0000090985 CCCTCATCAACTTGGACGATA pLKO.1 595 CDS 100% 4.950 6.930 N Coro1c n/a
3 TRCN0000090983 CCTACGTTTGAAATGCCAGAT pLKO.1 1756 3UTR 100% 4.050 5.670 N Coro1c n/a
4 TRCN0000349434 CCTACGTTTGAAATGCCAGAT pLKO_005 1756 3UTR 100% 4.050 5.670 N Coro1c n/a
5 TRCN0000313344 TCCACATAATGACCAGGTCAT pLKO_005 368 CDS 100% 4.050 5.670 N Coro1c n/a
6 TRCN0000090984 CCACATAATGACCAGGTCATT pLKO.1 369 CDS 100% 0.495 0.693 N Coro1c n/a
7 TRCN0000313283 ACCAATTGCTCTCCATGAAAT pLKO_005 866 CDS 100% 13.200 9.240 N Coro1c n/a
8 TRCN0000090986 CTCTCCATGAAATGGACACTA pLKO.1 874 CDS 100% 4.950 3.465 N Coro1c n/a
9 TRCN0000349882 ACAGGAGATTGTGGCGGAGAA pLKO_005 716 CDS 100% 4.050 2.835 N Coro1c n/a
10 TRCN0000090987 GCTCTCCATGAAATGGACACT pLKO.1 873 CDS 100% 2.640 1.848 N Coro1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02808 pDONR223 100% 88.5% 97.4% None (many diffs) n/a
2 ccsbBroad304_02808 pLX_304 0% 88.5% 97.4% V5 (many diffs) n/a
3 TRCN0000478831 TGCAGTGTCTATCATCAATGTTTT pLX_317 19.2% 88.5% 97.4% V5 (many diffs) n/a
Download CSV