Construct: ORF TRCN0000478839
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011816.1_s317c1
- Derived from:
- ccsbBroadEn_15072
- DNA Barcode:
- GGCTGTTAAAGTGCGCTGAATCTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SUFU (51684)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478839
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51684 | SUFU | SUFU negative regulator of ... | NM_016169.3 | 99.9% | 100% | 1452C>T |
| 2 | human | 51684 | SUFU | SUFU negative regulator of ... | XM_011539861.3 | 99.7% | 99.7% | 757_759delCAG;1455C>T |
| 3 | human | 51684 | SUFU | SUFU negative regulator of ... | XM_011539860.3 | 91.9% | 92% | 1297_1422del;1578C>T |
| 4 | human | 51684 | SUFU | SUFU negative regulator of ... | XM_011539858.3 | 91.7% | 91.8% | 757_759delCAG;1300_1425del;1581C>T |
| 5 | human | 51684 | SUFU | SUFU negative regulator of ... | NM_001178133.2 | 89.3% | 89.2% | 1297C>A;1299_1299delCins154 |
| 6 | human | 51684 | SUFU | SUFU negative regulator of ... | XM_011539864.3 | 89.1% | 89% | 757_759delCAG;1300C>A;1302_1302delCins154 |
| 7 | human | 51684 | SUFU | SUFU negative regulator of ... | XM_017016323.1 | 82.3% | 79.6% | (many diffs) |
| 8 | human | 51684 | SUFU | SUFU negative regulator of ... | XM_011539863.3 | 80.4% | 80.2% | (many diffs) |
| 9 | mouse | 24069 | Sufu | suppressor of fused homolog... | NM_001025391.2 | 91.1% | 97.7% | (many diffs) |
| 10 | mouse | 24069 | Sufu | suppressor of fused homolog... | NM_015752.3 | 90.9% | 97.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1518
- ORF length:
- 1452
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggagctgcgg cctagcggcg cccccggccc caccgcgccc ccggcccctg 121 gcccgactgc ccccccggcc ttcgcttcgc tctttccccc gggactgcac gccatctacg 181 gagagtgccg ccgcctttac cctgaccagc cgaacccgct ccaggttacc gctatcgtca 241 agtactggtt gggtggccca gaccccttgg actatgttag catgtacagg aatgtgggga 301 gcccttctgc taacatcccc gagcactggc actacatcag cttcggcctg agtgatctct 361 atggtgacaa cagagtccat gagtttacag gaacagatgg acctagtggt tttggctttg 421 agttgacctt tcgtctgaag agagaaactg gggagtctgc cccaccaaca tggcccgcag 481 agttaatgca gggcttggca cgatacgtgt tccagtcaga gaacaccttc tgcagtgggg 541 accatgtgtc ctggcacagc cctttggata acagtgagtc aagaattcag cacatgctgc 601 tgacagagga cccacagatg cagcccgtgc agacaccctt tggggtagtt accttcctcc 661 agatcgttgg tgtctgcact gaagagctac actcagccca gcagtggaac gggcagggca 721 tcctggagct gctgcggaca gtgcctattg ctggcggccc ctggctgata actgacatgc 781 ggaggggaga gaccatattt gagatcgatc cacacctgca agagagagtt gacaaaggca 841 tcgagacaga tggctccaac ctgagtggtg tcagtgccaa gtgtgcctgg gatgacctga 901 gccggccccc cgaggatgac gaggacagcc ggagcatctg catcggcaca cagccccggc 961 gactctctgg caaagacaca gagcagatcc gggagaccct gaggagagga ctcgagatca 1021 acagcaaacc tgtccttcca ccaatcaacc ctcagcggca gaatggcctc gcccacgacc 1081 gggccccgag ccgcaaagac agcctggaaa gtgacagctc cacggccatc attccccatg 1141 agctgattcg cacgcggcag cttgagagcg tacatcTGAA ATTCAACCAG GAGTCCGGAG 1201 CCCTCATTCC TCTCTGCCTA AGGGGCAGGC TCCTGCATGG ACGGCACTTT ACATATAAAA 1261 GTATCACAGG TGACATGGCC ATCACGTTTG TCTCCACGGG AGTGGAAGGC GCCTTTGCCA 1321 CTGAGGAGCA TCCTTACGCG GCTCATGGAC CCTGGTTACA AATTCTGTTG ACCGAAGAGT 1381 TTGTAGAGAA AATGTTGGAG GATTTAGAAG ATTTGACTTC TCCAGAGGAA TTCAAACTTC 1441 CCAAAGAGTA CAGCTGGCCT GAAAAGAAGC TGAAGGTCTC CATCCTGCCT GACGTGGTGT 1501 TCGACAGTCC GCTACATTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1561 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1621 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGGCTGTT AAAGTGCGCT 1681 GAATCTTACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt