Transcript: Human XM_011539863.3

PREDICTED: Homo sapiens SUFU negative regulator of hedgehog signaling (SUFU), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUFU (51684)
Length:
4890
CDS:
179..1588

Additional Resources:

NCBI RefSeq record:
XM_011539863.3
NBCI Gene record:
SUFU (51684)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539863.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358838 CAACGAGATCTCCACAAATAA pLKO_005 1662 3UTR 100% 15.000 21.000 N SUFU n/a
2 TRCN0000019467 CTTTGGATAACAGTGAGTCAA pLKO.1 501 CDS 100% 4.950 6.930 N SUFU n/a
3 TRCN0000019466 CGGCAGCTTGAGAGCGTACAT pLKO.1 1097 CDS 100% 1.650 2.310 N SUFU n/a
4 TRCN0000358840 TGGACGGCACTTTACATATAA pLKO_005 1180 CDS 100% 15.000 10.500 N SUFU n/a
5 TRCN0000358839 TCGGCCTGAGTGATCTCTATG pLKO_005 282 CDS 100% 10.800 7.560 N SUFU n/a
6 TRCN0000019465 CCTTTCGTCTGAAGAGAGAAA pLKO.1 366 CDS 100% 4.950 3.465 N SUFU n/a
7 TRCN0000019468 GACCGAAGAGTTTGTAGAGAA pLKO.1 1438 CDS 100% 4.950 3.465 N SUFU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539863.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15072 pDONR223 97.7% 80.4% 80.2% None (many diffs) n/a
2 ccsbBroad304_15072 pLX_304 0% 80.4% 80.2% V5 (many diffs) n/a
3 TRCN0000478839 GGCTGTTAAAGTGCGCTGAATCTT pLX_317 23.9% 80.4% 80.2% V5 (many diffs) n/a
Download CSV