Construct: ORF TRCN0000478882
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012561.1_s317c1
- Derived from:
- ccsbBroadEn_13272
- DNA Barcode:
- TAATACGAAGGTCCCAGTACGGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLB1 (151056)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478882
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 151056 | PLB1 | phospholipase B1 | XM_011532608.3 | 59.5% | 59.5% | 1_996del |
| 2 | human | 151056 | PLB1 | phospholipase B1 | XM_011532607.2 | 52.8% | 51.3% | (many diffs) |
| 3 | human | 151056 | PLB1 | phospholipase B1 | XM_011532606.3 | 52% | 50.5% | (many diffs) |
| 4 | human | 151056 | PLB1 | phospholipase B1 | XM_011532602.2 | 41.8% | 40.7% | (many diffs) |
| 5 | human | 151056 | PLB1 | phospholipase B1 | XM_011532603.2 | 41.8% | 40.7% | (many diffs) |
| 6 | human | 151056 | PLB1 | phospholipase B1 | XM_011532601.3 | 41.2% | 40.1% | (many diffs) |
| 7 | human | 151056 | PLB1 | phospholipase B1 | XR_001738647.2 | 37.7% | (many diffs) | |
| 8 | human | 151056 | PLB1 | phospholipase B1 | XM_017003434.1 | 35.7% | 34.7% | (many diffs) |
| 9 | human | 151056 | PLB1 | phospholipase B1 | XM_011532591.3 | 34.3% | 33.4% | (many diffs) |
| 10 | human | 151056 | PLB1 | phospholipase B1 | XM_011532590.2 | 34.2% | 33.2% | (many diffs) |
| 11 | human | 151056 | PLB1 | phospholipase B1 | XM_011532588.2 | 34.1% | 33.2% | (many diffs) |
| 12 | human | 151056 | PLB1 | phospholipase B1 | XM_011532593.2 | 33.8% | 32.9% | (many diffs) |
| 13 | human | 151056 | PLB1 | phospholipase B1 | XM_011532584.3 | 33.1% | 32.2% | (many diffs) |
| 14 | human | 151056 | PLB1 | phospholipase B1 | NM_153021.5 | 32.9% | 32% | (many diffs) |
| 15 | human | 151056 | PLB1 | phospholipase B1 | XM_017003433.2 | 32.9% | 32% | (many diffs) |
| 16 | human | 151056 | PLB1 | phospholipase B1 | XM_011532581.3 | 32.7% | 31.8% | (many diffs) |
| 17 | human | 151056 | PLB1 | phospholipase B1 | XM_017003432.2 | 32.6% | 31.7% | (many diffs) |
| 18 | human | 151056 | PLB1 | phospholipase B1 | XM_011532579.2 | 32.5% | 31.6% | (many diffs) |
| 19 | human | 151056 | PLB1 | phospholipase B1 | XM_011532589.2 | 32.4% | 31.5% | (many diffs) |
| 20 | human | 151056 | PLB1 | phospholipase B1 | XR_939663.3 | 32% | (many diffs) | |
| 21 | human | 151056 | PLB1 | phospholipase B1 | NM_001170585.1 | 31.1% | 30.2% | (many diffs) |
| 22 | human | 151056 | PLB1 | phospholipase B1 | NR_138141.1 | 27.2% | (many diffs) | |
| 23 | human | 151056 | PLB1 | phospholipase B1 | XR_001738646.2 | 26.5% | (many diffs) | |
| 24 | human | 151056 | PLB1 | phospholipase B1 | XM_011532609.2 | 19.5% | 25.8% | (many diffs) |
| 25 | human | 151056 | PLB1 | phospholipase B1 | XM_011532610.2 | 19.5% | 25.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1530
- ORF length:
- 1464
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gccagcagga gagaaagatg agccattgag tgtaaaacac gggaggccaa 121 tgaagtgtcc ctctcaggag agcccctatc tgttcagcta cagaaacagc aactacctga 181 ccagactgca gaaaccccaa gacaagcttg aggtaagaga aggagcggaa atcagatgtc 241 ctgacaaaga cccctccgat acggttccca cctcagttca taggctgaag ccggctgaca 301 tcaacgtaat tggagccctg ggtgactctc tcacggcagg caatggggcc gggtccacac 361 ctgggaacgt cttggacgtc ttgactcagt accgaggcct gtcctggagc gtcggcggag 421 atgagaacat cggcaccgtt accaccctgg cgaacatcct ccgggaattc aacccttccc 481 tgaagggctt ctctgttggc actgggaaag aaaccagtcc taatgccttc ttaaaccagg 541 ctgtggcagg aggccgagct gaggatctac ctgtccaggc caggaggctg gtggacctga 601 tgaagaatga cacgaggata cactttcagg aagactggaa gataataacc ctgtttatag 661 gcggcaatga cctctgtgat ttctgcaatg atctggtcca ctattctccc cagaacttca 721 cagacaacat tggaaaggcc ctggacatcc tccatgctga ggttcctcgg gcatttgtga 781 acctggtgac ggtgcttgag atcgtcaacc tgagggagct gtaccaggag aaaaaagtct 841 actgcccaag gatgatcctc aggtctctgt gtccctgtgt cctgaagttt gatgataact 901 caacagaact tgctaccctc atcgaattca acaagaagtt tcaggagaag acccaccaac 961 tgattgagag tgggcgatat gacacaaggg aagattttac tgtggttgtg cagccgttct 1021 ttgaaaacgt ggacatgcca aagacctcgg aaggattgcc tgacaactct ttcttcgctc 1081 ctgactgttt ccacttcagc agcaagtctc actcccgagc agccagtgct ctctggaaca 1141 atatgctgga gcctgttggc cagaagacga ctcgtcataa gtttgaaaac aagatcaata 1201 tcacatgtcc gaaccaggtc cagccgtttc tgaggaccTA CAAGAACAGC ATGCAGGGTC 1261 ATGGGACCTG GCTGCCATGC AGGGACAGAG CCCCTTCTGC CTTGCACCCT ACCTCAGTGC 1321 ATGCCCTGAG ACCTGCAGAC ATCCAAGTTG TGGCTGCTCT GGGGGATTCT CTGACCGCTG 1381 GCAATGGAAT TGGCTCCAAA CCAGACGACC TCCCCGATGT CACCACACAG TATCGGGGAC 1441 TGTCATACAG AGAAAGTAAA CCAGGGTTCT TATCAGACTC CTGGGTCAGC AAATCCAACA 1501 GGAAATGCAC CAGAAAAGCA CCAAATCCCT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1561 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1621 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATAATA 1681 CGAAGGTCCC AGTACGGTCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1741 tgaaagatt