Transcript: Human XM_011532607.2

PREDICTED: Homo sapiens phospholipase B1 (PLB1), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLB1 (151056)
Length:
3127
CDS:
314..3043

Additional Resources:

NCBI RefSeq record:
XM_011532607.2
NBCI Gene record:
PLB1 (151056)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155628 CCTAATATCCTTCGGGAGTTT pLKO.1 2735 CDS 100% 4.950 3.465 N PLB1 n/a
2 TRCN0000156446 CCATGAAGACTGGAAGGTCAT pLKO.1 2911 CDS 100% 4.050 2.835 N PLB1 n/a
3 TRCN0000156549 GACTTGTGGATTCAGGCTCAA pLKO.1 731 CDS 100% 4.050 2.835 N PLB1 n/a
4 TRCN0000154756 GCATTCCTCAATCAAGCTGTT pLKO.1 2810 CDS 100% 4.050 2.835 N PLB1 n/a
5 TRCN0000157010 GCTGAGGATCTTATGAGCCAA pLKO.1 2843 CDS 100% 2.640 1.848 N PLB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13272 pDONR223 100% 52.8% 51.3% None (many diffs) n/a
2 ccsbBroad304_13272 pLX_304 0% 52.8% 51.3% V5 (many diffs) n/a
3 TRCN0000478882 TAATACGAAGGTCCCAGTACGGTC pLX_317 20.3% 52.8% 51.3% V5 (many diffs) n/a
Download CSV