Construct: ORF TRCN0000478894
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017432.1_s317c1
- Derived from:
- ccsbBroadEn_04094
- DNA Barcode:
- ACAGAACTGTCCATGTATTTAATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM53 (79639)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478894
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79639 | TMEM53 | transmembrane protein 53 | NM_024587.4 | 100% | 100% | |
| 2 | human | 79639 | TMEM53 | transmembrane protein 53 | NM_001300747.2 | 89.1% | 89.1% | 182_183ins90 |
| 3 | human | 79639 | TMEM53 | transmembrane protein 53 | NM_001300748.2 | 88.8% | 88.8% | 182_183ins93 |
| 4 | human | 79639 | TMEM53 | transmembrane protein 53 | NM_001300746.1 | 73.6% | 73.6% | 0_1ins219 |
| 5 | human | 79639 | TMEM53 | transmembrane protein 53 | XM_011542138.2 | 57.7% | 57.7% | 0_1ins351 |
| 6 | mouse | 68777 | Tmem53 | transmembrane protein 53 | NM_026837.3 | 84% | 86.3% | (many diffs) |
| 7 | mouse | 68777 | Tmem53 | transmembrane protein 53 | NM_001285812.1 | 81.9% | 84% | (many diffs) |
| 8 | mouse | 68777 | Tmem53 | transmembrane protein 53 | NM_001285815.1 | 61.5% | 63.3% | (many diffs) |
| 9 | mouse | 68777 | Tmem53 | transmembrane protein 53 | NM_001285816.1 | 61.5% | 63.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 897
- ORF length:
- 831
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctcggcagag ctggactaca ccatcgagat cccggatcag ccctgctgga 121 gccagaagaa cagccccagc ccaggtggga aggaggcaga aactcggcag cctgtggtga 181 ttctcttggg ctggggtggc tgcaaggaca agaaccttgc caagtacagt gccatctacc 241 acaaaagggg ctgcatcgta atccgataca cagccccgtg gcacatggtc ttcttctccg 301 agtcactggg tatcccttca cttcgtgttt tggcccagaa gctgctcgag ctgctctttg 361 attatgagat tgagaaggag cccctgctct tccatgtctt cagcaacggt ggcgtcatgc 421 tgtaccgcta cgtgctggag ctcctgcaga cccgtcgctt ctgccgccTG CGTGTGGTGG 481 GCACCATCTT TGACAGCGCT CCTGGTGACA GCAACCTGGT AGGGGCTCTG CGGGCCCTGG 541 CAGCCATCCT GGAGCGCCGG GCCGCCATGC TGCGCCTGTT GCTGCTGGTG GCCTTTGCCC 601 TGGTGGTCGT CCTGTTCCAC GTCCTGCTTG CTCCCATCAC AGCCCTCTTC CACACCCACT 661 TCTATGACAG GCTACAGGAC GCGGGCTCTC GCTGGCCCGA GCTCTACCTC TACTCGAGGG 721 CTGACGAAGT AGTCCTGGCC AGAGACATAG AACGCATGGT GGAGGCACGC CTGGCACGCC 781 GGGTCCTGGC GCGTTCTGTG GATTTCGTGT CATCTGCACA CGTCAGCCAC CTCCGTGACT 841 ACCCTACTTA CTACACAAGC CTCTGTGTCG ACTTCATGCG CAACTGCGTC CGCTGCTGCC 901 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 961 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1021 ATATATCTTG TGGAAAGGAC GAACAGAACT GTCCATGTAT TTAATGACGC GTTAAGTCga 1081 caatcaacct ctggattaca aaatttgtga aagatt