Transcript: Mouse NM_001285815.1

Mus musculus transmembrane protein 53 (Tmem53), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tmem53 (68777)
Length:
1103
CDS:
441..1058

Additional Resources:

NCBI RefSeq record:
NM_001285815.1
NBCI Gene record:
Tmem53 (68777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285815.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276841 CTGGCGATAGCAACCTGATAG pLKO_005 661 CDS 100% 10.800 15.120 N Tmem53 n/a
2 TRCN0000323513 GGCTGCATTGTGATCCGATAC pLKO_005 405 5UTR 100% 6.000 8.400 N Tmem53 n/a
3 TRCN0000193586 GTATAGTGCTATCTACCACAA pLKO.1 380 5UTR 100% 4.050 5.670 N Tmem53 n/a
4 TRCN0000323523 GTATAGTGCTATCTACCACAA pLKO_005 380 5UTR 100% 4.050 5.670 N Tmem53 n/a
5 TRCN0000276842 TCCCTTCACTTCGCGTGATAG pLKO_005 469 CDS 100% 10.800 7.560 N Tmem53 n/a
6 TRCN0000173576 GACAAGAACCTGGCCAAGTAT pLKO.1 363 5UTR 100% 5.625 3.938 N Tmem53 n/a
7 TRCN0000374577 CAACAGCCTGTGGTGATTCTC pLKO_005 321 5UTR 100% 4.950 3.465 N Tmem53 n/a
8 TRCN0000173267 CCTGGCCAAGTATAGTGCTAT pLKO.1 371 5UTR 100% 4.950 3.465 N Tmem53 n/a
9 TRCN0000194515 GCACATGGTCTTCTTCTCTGA pLKO.1 437 5UTR 100% 2.640 1.848 N Tmem53 n/a
10 TRCN0000276840 TGTTGCTCCTGGCAGCATTTG pLKO_005 736 CDS 100% 10.800 6.480 N Tmem53 n/a
11 TRCN0000176166 GCTCCTCTTTGACTATGAGAT pLKO.1 506 CDS 100% 4.950 2.970 N Tmem53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285815.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04094 pDONR223 100% 61.5% 63.3% None (many diffs) n/a
2 ccsbBroad304_04094 pLX_304 0% 61.5% 63.3% V5 (many diffs) n/a
3 TRCN0000478894 ACAGAACTGTCCATGTATTTAATG pLX_317 51.5% 61.5% 63.3% V5 (many diffs) n/a
Download CSV