Transcript: Human NM_001300748.2

Homo sapiens transmembrane protein 53 (TMEM53), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TMEM53 (79639)
Length:
2143
CDS:
91..831

Additional Resources:

NCBI RefSeq record:
NM_001300748.2
NBCI Gene record:
TMEM53 (79639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422684 CAAGCCTCTGTGTCGACTTCA pLKO_005 788 CDS 100% 4.950 3.960 N TMEM53 n/a
2 TRCN0000418707 GACATAGAACGCATGGTGGAG pLKO_005 676 CDS 100% 2.160 1.728 N TMEM53 n/a
3 TRCN0000429908 AGGGTGAGCCCTAGTTGATTT pLKO_005 1159 3UTR 100% 13.200 9.240 N TMEM53 n/a
4 TRCN0000417818 CTGTAGCCCTTTGGGACTTTG pLKO_005 925 3UTR 100% 10.800 7.560 N TMEM53 n/a
5 TRCN0000133715 GCTGCTCTTTGATTATGAGAT pLKO.1 282 CDS 100% 4.950 3.465 N TMEM53 n/a
6 TRCN0000415107 TCCTGGCCAGAGACATAGAAC pLKO_005 665 CDS 100% 4.950 3.465 N TMEM53 n/a
7 TRCN0000136910 CCACTTCTATGACAGGCTACA pLKO.1 588 CDS 100% 4.050 2.835 N TMEM53 n/a
8 TRCN0000436620 ACCATCTTTGACAGCGCTCCT pLKO_005 415 CDS 100% 2.160 1.512 N TMEM53 n/a
9 TRCN0000430734 TCCATGTCTTCAGCAACGGTG pLKO_005 323 CDS 100% 2.160 1.512 N TMEM53 n/a
10 TRCN0000136601 CAAGGACAAGAACCTTGCCAA pLKO.1 228 CDS 100% 0.264 0.185 N TMEM53 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 1365 3UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 1365 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04094 pDONR223 100% 88.8% 88.8% None 182_183ins93 n/a
2 ccsbBroad304_04094 pLX_304 0% 88.8% 88.8% V5 182_183ins93 n/a
3 TRCN0000478894 ACAGAACTGTCCATGTATTTAATG pLX_317 51.5% 88.8% 88.8% V5 182_183ins93 n/a
Download CSV