Construct: ORF TRCN0000479064
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013612.1_s317c1
- Derived from:
- ccsbBroadEn_14449
- DNA Barcode:
- ATCCAGGAATTCCGCCCTTCGGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LCORL (254251)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479064
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_153686.8 | 100% | 100% | |
| 2 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_001365660.1 | 97.2% | 97.2% | 776_802del |
| 3 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_001365661.1 | 80.8% | 75.8% | (many diffs) |
| 4 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_001365662.1 | 77.9% | 74.5% | (many diffs) |
| 5 | human | 254251 | LCORL | ligand dependent nuclear re... | XM_017007965.1 | 73.5% | 73.5% | 427_428ins252 |
| 6 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_001365663.1 | 72.4% | 71.3% | (many diffs) |
| 7 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_001166139.2 | 49.6% | 44.1% | (many diffs) |
| 8 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_001365665.1 | 45.8% | 44.9% | (many diffs) |
| 9 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_001365658.1 | 23.2% | 17.8% | (many diffs) |
| 10 | human | 254251 | LCORL | ligand dependent nuclear re... | NM_001365659.1 | 23.2% | 17.8% | (many diffs) |
| 11 | human | 254251 | LCORL | ligand dependent nuclear re... | NR_158567.1 | 15.8% | (many diffs) | |
| 12 | human | 254251 | LCORL | ligand dependent nuclear re... | XM_011513822.3 | 15.7% | 14.2% | (many diffs) |
| 13 | human | 254251 | LCORL | ligand dependent nuclear re... | XM_011513821.3 | 15.6% | 14.1% | (many diffs) |
| 14 | human | 254251 | LCORL | ligand dependent nuclear re... | NR_158568.1 | 15.5% | 1_124del;344_345ins80;999_5523del | |
| 15 | human | 254251 | LCORL | ligand dependent nuclear re... | NR_158563.1 | 15.2% | (many diffs) | |
| 16 | human | 254251 | LCORL | ligand dependent nuclear re... | NR_158566.1 | 15.1% | (many diffs) | |
| 17 | human | 254251 | LCORL | ligand dependent nuclear re... | NR_158565.1 | 14.3% | 1_124del;277_1343del;2146_6670del | |
| 18 | human | 254251 | LCORL | ligand dependent nuclear re... | NR_136669.2 | 14.2% | (many diffs) | |
| 19 | human | 254251 | LCORL | ligand dependent nuclear re... | NR_158564.1 | 12.8% | (many diffs) | |
| 20 | human | 254251 | LCORL | ligand dependent nuclear re... | XM_011513823.3 | 11% | 9% | (many diffs) |
| 21 | human | 254251 | LCORL | ligand dependent nuclear re... | XM_017007962.2 | 11% | 9% | (many diffs) |
| 22 | human | 254251 | LCORL | ligand dependent nuclear re... | XM_017007963.2 | 11% | 9% | (many diffs) |
| 23 | mouse | 209707 | Lcorl | ligand dependent nuclear re... | NM_178142.5 | 94.1% | 91.8% | (many diffs) |
| 24 | mouse | 209707 | Lcorl | ligand dependent nuclear re... | XM_006503825.3 | 69.3% | 67.2% | (many diffs) |
| 25 | mouse | 209707 | Lcorl | ligand dependent nuclear re... | NM_001163073.1 | 47.8% | 41.7% | (many diffs) |
| 26 | mouse | 209707 | Lcorl | ligand dependent nuclear re... | NM_172153.3 | 34.2% | 28.1% | (many diffs) |
| 27 | mouse | 209707 | Lcorl | ligand dependent nuclear re... | XM_006503818.3 | 15.2% | 13.5% | (many diffs) |
| 28 | mouse | 209707 | Lcorl | ligand dependent nuclear re... | XM_011240709.2 | 15.2% | 13.4% | (many diffs) |
| 29 | mouse | 209707 | Lcorl | ligand dependent nuclear re... | XM_011240710.2 | 11.5% | 9.8% | (many diffs) |
| 30 | mouse | 209707 | Lcorl | ligand dependent nuclear re... | XM_011240711.1 | 10.6% | 8.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1020
- ORF length:
- 954
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga caagggaaga gagagaatgg ccgctgccgc cgccgctgct gccgccgccg 121 ccgccgccgc tcagtgccgg agccctcggt gcgcggcgga gagaagagga ttccggcggg 181 aactcgactc ttggcgccac cgcctcatgc actgtgtagg ttttgagagt attttagaag 241 ggctttatgg accacggcta cgaagagacc tcagtttatt tgaagactgt gaaccagaag 301 agctgactga ctggtctatg gatgaaaaat gttcattttg taacctacag agagaagcag 361 tcagtgattg tataccatct cttgattctt cacagtcaac accaacagag gagctatcat 421 ctcagggcca gtccaacact gataagattg aatgccaagc agaaaattac ctaaatgcac 481 tctttcgaaa gaaagatctt cctcagaact gtgaTCCTAA CATTCCCCTA GTTGCTCAGG 541 AATTAATGAA AAAGATGATA CGTCAATTTG CGATTGAGTA CATTTCAAAA AGTGGTAAAA 601 CTCAAGAGAA TAGAAATGGT TCAATTGGAC CAAGTATAGT ATGTAAAAGT ATCCAAATGA 661 ATCAAGCAGA AAACTCCCTT CAGGAAGAGC AGGAAGGCCC CTTAGACCTC ACTGTGAATC 721 GAATGCAAGA ACAAAATACT CAGCAAGGGG ATGGAGTGTT AGATCTCTCT ACAAAGAAAA 781 CCAGCATAAA ATCTGAAGAG TCATCCATAT GTGATCCTTC TTCTGAAAAT TCAGTGGCTG 841 GCATGCTACA AGTGAAAACT GATGAGAAAC TGAATGTGTC TGATGAGAAT ACAGCAAGTT 901 GCCCTTTGAG CCCCATTAAG ATGTGCCTTA ATCGTCCCAT TGAATGGAAT CTGAATTTGA 961 CAACAGCATC TCTAACGAGC TGTACAGTTC ATAACCAAAA TCTCAAAAGC GAAGAGAAAT 1021 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1081 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1141 TTTATATATC TTGTGGAAAG GACGAATCCA GGAATTCCGC CCTTCGGCAA CGCGTTAAGT 1201 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt