Transcript: Mouse XM_006503825.3

PREDICTED: Mus musculus ligand dependent nuclear receptor corepressor-like (Lcorl), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lcorl (209707)
Length:
5776
CDS:
281..973

Additional Resources:

NCBI RefSeq record:
XM_006503825.3
NBCI Gene record:
Lcorl (209707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193843 CCTTAGTTGCTCAGGAATTAA pLKO.1 738 CDS 100% 15.000 21.000 N Lcorl n/a
2 TRCN0000193873 CCCACACTGATAAGATTGAAT pLKO.1 645 CDS 100% 5.625 7.875 N Lcorl n/a
3 TRCN0000435943 AGAACTGTGATCCTAACATTC pLKO_005 717 CDS 100% 10.800 8.640 N LCORL n/a
4 TRCN0000435776 GAAGCAGTCAGTGATTGTATA pLKO_005 566 CDS 100% 13.200 9.240 N LCORL n/a
5 TRCN0000194112 GATCCTAACATTCCCTTAGTT pLKO.1 725 CDS 100% 5.625 3.938 N Lcorl n/a
6 TRCN0000015160 GCTACGAAGAGACCTCAGTTT pLKO.1 469 CDS 100% 4.950 3.465 N LCORL n/a
7 TRCN0000015162 GCTGTACAGTTCATAACCAAA pLKO.1 1091 3UTR 100% 4.950 3.465 N LCORL n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1781 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14449 pDONR223 98.2% 69.3% 67.2% None (many diffs) n/a
2 ccsbBroad304_14449 pLX_304 0% 69.3% 67.2% V5 (many diffs) n/a
3 TRCN0000479064 ATCCAGGAATTCCGCCCTTCGGCA pLX_317 52.9% 69.3% 67.2% V5 (many diffs) n/a
Download CSV