Transcript: Human NR_136669.2

Homo sapiens ligand dependent nuclear receptor corepressor like (LCORL), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
LCORL (254251)
Length:
5310
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136669.2
NBCI Gene record:
LCORL (254251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427046 CCCTAAGTTTAAATACGTAAT pLKO_005 1034 3UTR 100% 10.800 15.120 N LCORL n/a
2 TRCN0000015161 CCCATTGAATGGAATCTGAAT pLKO.1 701 3UTR 100% 4.950 6.930 N LCORL n/a
3 TRCN0000423915 TAAATCTCCTTCAACGTTATA pLKO_005 1232 3UTR 100% 13.200 9.240 N LCORL n/a
4 TRCN0000435857 TGAATGTGTCTGATGAGAATA pLKO_005 636 3UTR 100% 13.200 9.240 N LCORL n/a
5 TRCN0000435943 AGAACTGTGATCCTAACATTC pLKO_005 364 3UTR 100% 10.800 7.560 N LCORL n/a
6 TRCN0000015159 CCAACACTGATAAGATTGAAT pLKO.1 292 3UTR 100% 5.625 3.938 N LCORL n/a
7 TRCN0000015158 GCCTTAATCGTCCCATTGAAT pLKO.1 690 3UTR 100% 5.625 3.938 N LCORL n/a
8 TRCN0000015160 GCTACGAAGAGACCTCAGTTT pLKO.1 196 3UTR 100% 4.950 3.465 N LCORL n/a
9 TRCN0000015162 GCTGTACAGTTCATAACCAAA pLKO.1 744 3UTR 100% 4.950 3.465 N LCORL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14449 pDONR223 98.2% 14.2% None (many diffs) n/a
2 ccsbBroad304_14449 pLX_304 0% 14.2% V5 (many diffs) n/a
3 TRCN0000479064 ATCCAGGAATTCCGCCCTTCGGCA pLX_317 52.9% 14.2% V5 (many diffs) n/a
Download CSV