Construct: ORF TRCN0000479081
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008093.1_s317c1
- Derived from:
- ccsbBroadEn_11533
- DNA Barcode:
- GGAAGTCTTATACACCCAGCATCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAD51AP1 (10635)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479081
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10635 | RAD51AP1 | RAD51 associated protein 1 | NM_006479.5 | 79% | 79.1% | 1_210del;618T>C |
2 | human | 10635 | RAD51AP1 | RAD51 associated protein 1 | NM_001130862.2 | 75.1% | 75.2% | 1_261del;669T>C |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 861
- ORF length:
- 795
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tttagatgac aagctctacc agagagactt agaagttgca ctagctttat 121 cagtgaagga acttccaaca gtcaccacta atgtgcagaa ctctcaagat aaaagcattg 181 aaaaacatgg cagtagtaaa atagaaacaa tgaataagtc tcctcatatc tctaattgca 241 gtgtagccag tgattattta gatttggata agattactgt ggaagatgat gttggtggtg 301 ttcaagggaa aagaaaagca gcatctaaag ctgcagcaca gcagaggaag attcttctgg 361 aaggcagtga tggtgatagt gctaatgaca ctgaaccaga ctttgcacct ggtgaagatt 421 ctgaggatga ttctgatttt tgtgagagtg aggataatga cgaagacTTC TCCATGAGAA 481 AAAGTAAAGT TAAAGAAATT AAAAAGAAAG AAGTGAAGGT AAAATCCCCA GTAGAAAAGA 541 AAGAGAAGAA ATCTAAATCC AAATGTAATG CTTTGGTGAC TTCGGTGGAC TCTGCTCCAG 601 CTGCCGTCAA ATCAGAATCT CAGTCCTTGC CAAAAAAGGT TTCTCTGTCT TCAGATACCA 661 CTAGGAAACC ATTAGAAATA CGCAGTCCTT CAGCTGAAAG CAAGAAACCT AAATGGGTCC 721 CACCAGCGGC ATCTGGAGGT AGCAGAAGTA GCAGCAGCCC ACTGGTGGTA GTGTCTGTGA 781 AGTCTCCCAA TCAGAGTCTC CGCCTTGGCT TGTCCAGATT AGCACGAGTT AAACCTTTGC 841 ATCCAAATGC CACTAGCACC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 901 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 961 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGGAA GTCTTATACA 1021 CCCAGCATCT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt