Transcript: Human NM_001130862.2

Homo sapiens RAD51 associated protein 1 (RAD51AP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
RAD51AP1 (10635)
Length:
2163
CDS:
51..1109

Additional Resources:

NCBI RefSeq record:
NM_001130862.2
NBCI Gene record:
RAD51AP1 (10635)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130862.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222048 CATATCTCTAATTGCAGTGTA pLKO.1 471 CDS 100% 4.950 6.930 N RAD51AP1 n/a
2 TRCN0000296395 CCATTACCATGTCCTATAAAT pLKO_005 1215 3UTR 100% 15.000 10.500 N RAD51AP1 n/a
3 TRCN0000222045 GCTGAAAGCAAGAAACCTAAA pLKO.1 939 CDS 100% 10.800 7.560 N RAD51AP1 n/a
4 TRCN0000296335 TTAGAAGTTGCACTAGCTTTA pLKO_005 345 CDS 100% 10.800 7.560 N RAD51AP1 n/a
5 TRCN0000222044 CCAGTCAATTACTCACAGTTT pLKO.1 78 CDS 100% 4.950 3.465 N RAD51AP1 n/a
6 TRCN0000289804 CCAGTCAATTACTCACAGTTT pLKO_005 78 CDS 100% 4.950 3.465 N RAD51AP1 n/a
7 TRCN0000222046 GCACGAGTTAAACCTTTGCAT pLKO.1 1068 CDS 100% 3.000 2.100 N RAD51AP1 n/a
8 TRCN0000307139 GCACGAGTTAAACCTTTGCAT pLKO_005 1068 CDS 100% 3.000 2.100 N RAD51AP1 n/a
9 TRCN0000222047 GCAGTGATGGTGATAGTGCTA pLKO.1 610 CDS 100% 2.640 1.848 N RAD51AP1 n/a
10 TRCN0000307137 GCAGTGATGGTGATAGTGCTA pLKO_005 610 CDS 100% 2.640 1.848 N RAD51AP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130862.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02490 pDONR223 100% 100% 100% None n/a
2 ccsbBroadEn_02491 pDONR223 100% 95.1% 95.1% None 210_260del n/a
3 ccsbBroad304_02491 pLX_304 0% 95.1% 95.1% V5 210_260del n/a
4 TRCN0000470458 CTAAAGTGTAAATATCATCTACGG pLX_317 34.4% 95% 64.2% V5 (not translated due to prior stop codon) 210_260del;721_722insC n/a
5 ccsbBroadEn_11533 pDONR223 100% 75.1% 75.2% None 1_261del;669T>C n/a
6 ccsbBroad304_11533 pLX_304 0% 75.1% 75.2% V5 1_261del;669T>C n/a
7 TRCN0000479081 GGAAGTCTTATACACCCAGCATCT pLX_317 49.5% 75.1% 75.2% V5 1_261del;669T>C n/a
Download CSV