Construct: ORF TRCN0000479135
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014207.1_s317c1
- Derived from:
- ccsbBroadEn_12498
- DNA Barcode:
- GCCTACTGAAACCAAATCGAGGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXL17 (64839)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479135
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64839 | FBXL17 | F-box and leucine rich repe... | NM_001163315.3 | 43.2% | 43.2% | 1_1194del |
| 2 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_005272048.4 | 38.1% | 36.4% | (many diffs) |
| 3 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_011543574.3 | 31.1% | 30.2% | (many diffs) |
| 4 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_011543575.2 | 30.9% | 30% | (many diffs) |
| 5 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_011543576.3 | 29.5% | 27.2% | (many diffs) |
| 6 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_011543577.2 | 26.8% | 26.2% | (many diffs) |
| 7 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_011543578.2 | 26.2% | 26.2% | 1_1194del;1746_1746delAins358 |
| 8 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_017009729.2 | 23% | 20.9% | (many diffs) |
| 9 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_011543579.2 | 16% | 14.9% | (many diffs) |
| 10 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_011543580.2 | 16% | 14.9% | (many diffs) |
| 11 | human | 64839 | FBXL17 | F-box and leucine rich repe... | XM_005272050.4 | 14.9% | 14.9% | (many diffs) |
| 12 | mouse | 50758 | Fbxl17 | F-box and leucine-rich repe... | NM_015794.1 | 39.8% | 42.2% | (many diffs) |
| 13 | mouse | 50758 | Fbxl17 | F-box and leucine-rich repe... | XR_385343.3 | 6.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 978
- ORF length:
- 909
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctgataat ggcgtatgtg ttttagcatt taaatgtcct ggacttctta 121 ggtatacagc ctacaggtgt aaacagcttt ctgacacctc tattattgcg gttgcctctc 181 actgtccttt acttcagaaa gtgcatgtag gcaaccagga caaactcact gatgaaggac 241 tcaagcagct gggctcaaaa tgcagagaac tcaaagatat tcatttcggc cagtgttaca 301 agatctcaga tgaaggcatg atcgtcatag ctaagggctg tctgaaatta caaaggatat 361 acatgcagga aaacaaatta gtgacagatc agtcagtgaa agcatttgct gaacactgtc 421 ctgagcttca atatgtaggc ttcatgggtt gttcagtcac ttctaaagga gtcattcacc 481 taaccaagct aagaaacctt tccagcttgg acctacgtca tatcactgaa ctggataatG 541 AAACCGTGAT GGAAATTGTC AAGAGGTGCA AAAATCTTAG CTCTCTCAAT CTCTGTCTGA 601 ACTGGATCAT AAATGACAGG TGTGTGGAGG TCATTGCAAA GGAAGGACAA AACCTGAAAG 661 AGCTATATTT GGTGTCCTGT AAAATCACAG ATTATGCACT GATAGCCATT GGGCGATACA 721 GCATGACAAT AGAGACTGTG GATGTCGGAT GGTGTAAAGA AATCACAGAC CAAGGAGCCA 781 CCCTGATTGC ACAGAGCAGC AAGTCTCTGA GATATTTGGG GCTGATGAGA TGTGATAAAG 841 TCAACGAAGT GACGGTGGAA CAGCTGGTGC AGCAGTACCC CCACATCACC TTCAGCACCG 901 TCCTGCAGGA CTGCAAGAGG ACCTTGGAGA GAGCCTATCA GATGGGCTGG ACCCCCAACA 961 TGTCTGCCGC CTCCTCCTTG CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1021 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1081 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGCCTACT GAAACCAAAT 1141 CGAGGTCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt