Transcript: Human XM_017009729.2

PREDICTED: Homo sapiens F-box and leucine rich repeat protein 17 (FBXL17), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXL17 (64839)
Length:
5468
CDS:
402..2105

Additional Resources:

NCBI RefSeq record:
XM_017009729.2
NBCI Gene record:
FBXL17 (64839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118271 CAAAGGATATACATGCAGGAA pLKO.1 1878 CDS 100% 2.640 1.848 N FBXL17 n/a
2 TRCN0000118269 GCCTCTCACTGTCCTTTACTT pLKO.1 1701 CDS 100% 5.625 3.375 N FBXL17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12498 pDONR223 100% 23% 20.9% None (many diffs) n/a
2 ccsbBroad304_12498 pLX_304 0% 23% 20.9% V5 (many diffs) n/a
3 TRCN0000479135 GCCTACTGAAACCAAATCGAGGTC pLX_317 48.1% 23% 20.9% V5 (many diffs) n/a
Download CSV