Transcript: Mouse XR_385343.3

PREDICTED: Mus musculus F-box and leucine-rich repeat protein 17 (Fbxl17), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxl17 (50758)
Length:
12108
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385343.3
NBCI Gene record:
Fbxl17 (50758)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092533 GCATAGCATAAGCGCACTGTT pLKO.1 4330 3UTR 100% 4.950 6.930 N Fbxl17 n/a
2 TRCN0000092534 CGTCGGATGGTGTAAAGAAAT pLKO.1 3946 3UTR 100% 13.200 9.240 N Fbxl17 n/a
3 TRCN0000092537 AGATGTGACAAAGTCAATGAA pLKO.1 4031 3UTR 100% 5.625 3.938 N Fbxl17 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8374 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12498 pDONR223 100% 6.2% None (many diffs) n/a
2 ccsbBroad304_12498 pLX_304 0% 6.2% V5 (many diffs) n/a
3 TRCN0000479135 GCCTACTGAAACCAAATCGAGGTC pLX_317 48.1% 6.2% V5 (many diffs) n/a
Download CSV