Construct: ORF TRCN0000479212
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012067.1_s317c1
- Derived from:
- ccsbBroadEn_15478
- DNA Barcode:
- CCAAGTGGTTCAAGCATAGACGCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IL6R (3570)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479212
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3570 | IL6R | interleukin 6 receptor | XM_005245140.3 | 74.7% | 74% | (many diffs) |
| 2 | human | 3570 | IL6R | interleukin 6 receptor | NM_001206866.1 | 71.7% | 71.1% | (many diffs) |
| 3 | human | 3570 | IL6R | interleukin 6 receptor | XM_005245139.2 | 70.2% | 69.5% | (many diffs) |
| 4 | human | 3570 | IL6R | interleukin 6 receptor | NM_181359.3 | 69.2% | 68.5% | (many diffs) |
| 5 | human | 3570 | IL6R | interleukin 6 receptor | XM_017001201.2 | 68.1% | 67.4% | (many diffs) |
| 6 | human | 3570 | IL6R | interleukin 6 receptor | XM_006711299.4 | 66.3% | 65.7% | (many diffs) |
| 7 | human | 3570 | IL6R | interleukin 6 receptor | NM_000565.4 | 54% | 53.5% | (many diffs) |
| 8 | human | 3570 | IL6R | interleukin 6 receptor | XM_006711298.2 | 52.2% | 51.7% | (many diffs) |
| 9 | human | 3570 | IL6R | interleukin 6 receptor | XM_017001200.2 | 50.4% | 50% | (many diffs) |
| 10 | human | 3570 | IL6R | interleukin 6 receptor | XM_017001199.2 | 48.9% | 48.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 837
- ORF length:
- 768
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctggccgtc ggctgcgcgc tgctggctgc cctgctggcc gcgccgggag 121 cggcgctggc cccaaggcgc tgccctgcgc aggaggtggc aagaggcgtg ctgaccagtc 181 tgccaggaga cagcgtgact ctgacctgcc cgggggtaga gccggaagac aatgccactg 241 ttcactgggt gctcaggaag ccggctgcag gctcccaccc cagcagatgg gctggcatgg 301 gaaggaggct gctgctgagg tcggtgcagc tccacgactc tggaaactat tcatgctacc 361 gggccggccg cccagctggg actgtgcact tgctggtgga tgttcccccc gaggagcccc 421 agctctcctg cttccggaag agccccctca gcaatgttgt ttgtgagtgg ggtcctcgga 481 gcaccccatc cctgacgaca aaggctgtgc tcttggtgag gaagtttcag aacagtccgg 541 ccgaagactt ccaGGAGCCG TGCCAGTATT CCCAGGAGTC CCAGAAGTTC TCCTGCCAGT 601 TAGCAGTCCC GGAGGGAGAC AGCTCTTTCT ACATAGTGTC CATGTGCGTC GCCAGTAGTG 661 TCGGGAGCAA GTTCAGCAAA ACTCAAACCT TTCAGGGTTG TGGAATCTTG CAGCCTGATC 721 CGCCTGCCAA CATCACAGTC ACTGCCGTGG CCAGAAACCC CCGCTGGCTC AGTGTCACCT 781 GGCAAGACCC CCACTCCTGG AACTCATCTT TCTACAGACT ACTTCTTCCC CAGATTGCCA 841 ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC 901 GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT 961 ATATCTTGTG GAAAGGACGA CCAAGTGGTT CAAGCATAGA CGCGACGCGT TAAGTCgaca 1021 atcaacctct ggattacaaa atttgtgaaa gatt