Transcript: Human NM_001206866.1

Homo sapiens interleukin 6 receptor (IL6R), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
IL6R (3570)
Length:
2058
CDS:
438..1496

Additional Resources:

NCBI RefSeq record:
NM_001206866.1
NBCI Gene record:
IL6R (3570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378748 TATCGGGCTGAACGGTCAAAG pLKO_005 1206 CDS 100% 10.800 15.120 N IL6R n/a
2 TRCN0000058779 CCACTCCTGGAACTCATCTTT pLKO.1 1160 CDS 100% 5.625 4.500 N IL6R n/a
3 TRCN0000058780 CTCTGGAAACTATTCATGCTA pLKO.1 707 CDS 100% 3.000 2.100 N IL6R n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1621 3UTR 100% 5.625 2.813 Y EID2B n/a
5 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1548 3UTR 100% 4.950 2.475 Y n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1621 3UTR 100% 5.625 2.813 Y KLHL30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00851 pDONR223 100% 91.4% 87.9% None (many diffs) n/a
2 ccsbBroad304_00851 pLX_304 0% 91.4% 87.9% V5 (many diffs) n/a
3 TRCN0000480795 TGACATTATTTCGGTTGGAAAAGA pLX_317 37.9% 91.4% 87.9% V5 (many diffs) n/a
4 ccsbBroadEn_00850 pDONR223 100% 72.6% 69% None (many diffs) n/a
5 ccsbBroad304_00850 pLX_304 0% 72.6% 69% V5 (many diffs) n/a
6 TRCN0000472622 CGTTGCGCAAGTCCCGGGCGTCAT pLX_317 31.7% 72.6% 69% V5 (many diffs) n/a
7 ccsbBroadEn_15478 pDONR223 0% 72.5% 69% None (many diffs) n/a
8 ccsbBroad304_15478 pLX_304 0% 72.5% 69% V5 (many diffs) n/a
9 TRCN0000479212 CCAAGTGGTTCAAGCATAGACGCG pLX_317 37% 71.7% 71.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV