Transcript: Human XM_006711298.2

PREDICTED: Homo sapiens interleukin 6 receptor (IL6R), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL6R (3570)
Length:
5812
CDS:
288..1742

Additional Resources:

NCBI RefSeq record:
XM_006711298.2
NBCI Gene record:
IL6R (3570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058778 GCAGGCACTTACTACTAATAA pLKO.1 1328 CDS 100% 15.000 21.000 N IL6R n/a
2 TRCN0000372671 ATGCATCCGCCGTACTCTTTG pLKO_005 1545 CDS 100% 10.800 15.120 N IL6R n/a
3 TRCN0000378748 TATCGGGCTGAACGGTCAAAG pLKO_005 1056 CDS 100% 10.800 15.120 N IL6R n/a
4 TRCN0000058779 CCACTCCTGGAACTCATCTTT pLKO.1 1010 CDS 100% 5.625 4.500 N IL6R n/a
5 TRCN0000372728 CTGGACCCTGTGGATGATAAA pLKO_005 1765 3UTR 100% 13.200 9.240 N IL6R n/a
6 TRCN0000058782 CTCCTCTGCATTGCCATTGTT pLKO.1 1470 CDS 100% 5.625 3.938 N IL6R n/a
7 TRCN0000058781 AGCCCTTATGACATCAGCAAT pLKO.1 1698 CDS 100% 4.950 3.465 N IL6R n/a
8 TRCN0000058780 CTCTGGAAACTATTCATGCTA pLKO.1 557 CDS 100% 3.000 2.100 N IL6R n/a
9 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 4000 3UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00850 pDONR223 100% 96.6% 96.6% None 948_995del n/a
2 ccsbBroad304_00850 pLX_304 0% 96.6% 96.6% V5 948_995del n/a
3 TRCN0000472622 CGTTGCGCAAGTCCCGGGCGTCAT pLX_317 31.7% 96.6% 96.6% V5 948_995del n/a
4 ccsbBroadEn_15478 pDONR223 0% 96.6% 96.6% None 93G>A;948_995del n/a
5 ccsbBroad304_15478 pLX_304 0% 96.6% 96.6% V5 93G>A;948_995del n/a
6 TRCN0000479212 CCAAGTGGTTCAAGCATAGACGCG pLX_317 37% 52.2% 51.7% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_00851 pDONR223 100% 75.4% 73.6% None 948_995del;1113_1206del;1238_1452del n/a
8 ccsbBroad304_00851 pLX_304 0% 75.4% 73.6% V5 948_995del;1113_1206del;1238_1452del n/a
9 TRCN0000480795 TGACATTATTTCGGTTGGAAAAGA pLX_317 37.9% 75.4% 73.6% V5 948_995del;1113_1206del;1238_1452del n/a
Download CSV