Construct: ORF TRCN0000479233
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000552.2_s317c1
- Derived from:
- ccsbBroadEn_00297
- DNA Barcode:
- AGCAATCTTACCGGAGCAGTTACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CEACAM8 (1088)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479233
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | NM_001816.4 | 100% | 100% | |
| 2 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026195.1 | 100% | 100% | |
| 3 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026196.1 | 93.2% | 92.2% | (many diffs) |
| 4 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026194.1 | 90.4% | 89.6% | (many diffs) |
| 5 | human | 4680 | CEACAM6 | CEA cell adhesion molecule 6 | NM_002483.7 | 86.1% | 78.2% | (many diffs) |
| 6 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | XM_011527206.2 | 83.4% | 70.5% | (many diffs) |
| 7 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_011526340.2 | 82.2% | 79.2% | (many diffs) |
| 8 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001184816.2 | 81.5% | 72.7% | (many diffs) |
| 9 | human | 4680 | CEACAM6 | CEA cell adhesion molecule 6 | XM_011526990.2 | 81% | 73% | (many diffs) |
| 10 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_011526341.1 | 73% | 68.6% | 703_704ins178;765_766ins104 |
| 11 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_011526342.1 | 73% | 68.6% | 703_704ins178;765_766ins104 |
| 12 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026198.1 | 73% | 68.6% | 703_704ins178;765_766ins104 |
| 13 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001184813.2 | 69.9% | 62.2% | (many diffs) |
| 14 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001024912.3 | 65.5% | 58.1% | (many diffs) |
| 15 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001184815.2 | 65.2% | 58.1% | (many diffs) |
| 16 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001205344.2 | 65% | 57.6% | (many diffs) |
| 17 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001712.5 | 57.8% | 51.3% | (many diffs) |
| 18 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026197.2 | 53.4% | 50.3% | (many diffs) |
| 19 | human | 1048 | CEACAM5 | CEA cell adhesion molecule 5 | XM_017026146.2 | 48.4% | 43.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1113
- ORF length:
- 1047
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gcccatctca gccccttcct gcagatggcg catcccctgg caggggctcc 121 tgctcacagc ctcacttttc accttctgga acccgcccac cactgctcag ctcactattg 181 aagctgtgcc atccaatgct gcagagggga aggaggttct tctacttgtc cacaatctgc 241 cccaggaccc tcgtggctac aactggtaca aaggggaaac agtggatgcc aaccgtcgaa 301 ttataggata tgtaatatca aatcaacaga ttaccccagg gcctgcatac agcaatcgag 361 agacaatata ccccaatgca tccctgctga tgcggaacgt caccagaaat gacacaggat 421 cctacaccct acaagtcata aagctaaatc ttatgagtga agaagtaact ggccagttca 481 gcgtacatcc ggagactccc aagccctcca tctccagcaa caactccaac cccgtggagg 541 acaaggatgc tgtggccttc acctgtgaac ctgagactca gaacacaacc tacctgtggt 601 gggtaaatgg tcagagtctc ccggtcagtc ccaggctgca gctgtccaat ggcaacagga 661 ccctcactct acTCAGTGTC ACAAGGAATG ACGTAGGACC CTATGAATGT GAAATACAGA 721 ACCCAGCGAG TGCAAACTTC AGTGACCCAG TCACCCTGAA TGTCCTCTAT GGCCCAGATG 781 CCCCCACCAT TTCCCCTTCA GACACCTATT ACCATGCAGG GGTAAATCTC AACCTCTCCT 841 GCCATGCGGC CTCTAATCCA CCCTCACAGT ATTCTTGGTC TGTCAATGGC ACATTCCAGC 901 AATACACACA AAAGCTCTTT ATCCCCAACA TCACTACAAA GAACAGCGGA TCCTATGCCT 961 GCCACACCAC TAACTCAGCC ACTGGCCGCA ACAGGACCAC AGTCAGGATG ATCACAGTCT 1021 CTGATGCTTT AGTACAAGGA AGTTCTCCTG GCCTCTCAGC TAGAGCCACT GTCAGCATCA 1081 TGATTGGAGT ACTGGCCAGG GTGGCTCTGA TATACCCAAC TTTCTTGTAC AAAGTGGTTG 1141 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1201 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAG 1261 CAATCTTACC GGAGCAGTTA CAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1321 ttgtgaaaga tt