Construct: ORF TRCN0000479327
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009431.1_s317c1
- Derived from:
- ccsbBroadEn_14030
- DNA Barcode:
- AGTGTCGATCCTATACAAAAAACA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- MELK (9833)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479327
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9833 | MELK | maternal embryonic leucine ... | NM_014791.4 | 99.7% | 1% | (many diffs) |
| 2 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518076.2 | 99.7% | 1% | (many diffs) |
| 3 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518077.1 | 99.7% | 1% | (many diffs) |
| 4 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518078.2 | 99.7% | 1% | (many diffs) |
| 5 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518079.1 | 99.7% | 1% | (many diffs) |
| 6 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518080.1 | 95.3% | 1.1% | (many diffs) |
| 7 | human | 9833 | MELK | maternal embryonic leucine ... | NM_001256689.1 | 94.9% | 3.2% | (many diffs) |
| 8 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518081.2 | 94.9% | 3.2% | (many diffs) |
| 9 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518082.2 | 94.9% | 3.2% | (many diffs) |
| 10 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518083.2 | 94.9% | 3.2% | (many diffs) |
| 11 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518084.2 | 94.9% | 3.2% | (many diffs) |
| 12 | human | 9833 | MELK | maternal embryonic leucine ... | NM_001256685.1 | 93.4% | 1.1% | (many diffs) |
| 13 | human | 9833 | MELK | maternal embryonic leucine ... | NM_001256687.1 | 92.4% | 1.1% | (many diffs) |
| 14 | human | 9833 | MELK | maternal embryonic leucine ... | NM_001256690.1 | 88.9% | 3% | (many diffs) |
| 15 | human | 9833 | MELK | maternal embryonic leucine ... | NM_001256688.1 | 88.8% | 1.1% | (many diffs) |
| 16 | human | 9833 | MELK | maternal embryonic leucine ... | NM_001256691.1 | 87.6% | 3.4% | (many diffs) |
| 17 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518085.1 | 87.1% | 1.2% | (many diffs) |
| 18 | human | 9833 | MELK | maternal embryonic leucine ... | NM_001256692.1 | 79.5% | 1.3% | (many diffs) |
| 19 | human | 9833 | MELK | maternal embryonic leucine ... | NR_046337.1 | 71.4% | (many diffs) | |
| 20 | human | 9833 | MELK | maternal embryonic leucine ... | NM_001256693.1 | 70% | 1.4% | (many diffs) |
| 21 | human | 9833 | MELK | maternal embryonic leucine ... | XM_011518086.2 | 56.8% | 1.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 174
- ORF length:
- 108
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gattatgatg aacttctcaa atattatgaa ttacatgaaa ctattgggac 121 aggtggcttt gcaaaggtca aacttgcctg ccatatcctt actggagaga tggtagctat 181 aaaaatcatg gataaaaaca cactagggag tgatttgccc cggatcaaaa cggagattga 241 ggccttgaag aacctgagac atcagcatat atgtcaactc taccatgtgc tagagacagc 301 caacaaaata ttcatggttc ttgagtactg ccctggagga gagctgtttg actatataat 361 ttcccaggat cgcctgtcag aagaggagac ccgggttgtc ttccgtcaga tagtatctgc 421 tgttgcttat gtgcacagcc agggctatgc tcacagggac ctcaagccag aaaatttgct 481 gtttgatgaa tatcataaat taaagctgat tgactttggt ctctgtgcaa aacccaaggg 541 taacaaggat taccatctac agacatgctg tgggagtctg gcttatgcag cacctgagtt 601 aatacaaggc aaatcatatc ttggatcaga ggcagatgtt tggagcatgg gcatactgtt 661 atatgttctt atgtgtggat ttctaccatt tgatgatgat aatgtaatgg ctttatacaa 721 gaagattatg agaggaaaat atgatgttcc caagtggctc tctcccagta gcattctgct 781 tcttcaacaa atgctgcagg tggacccaaa gaaacggatt tctatgaaaa atctattgaa 841 ccatccctgg atcatgcaag attacaacta tcctgttgag tggcaaagca agaatccttt 901 tattcacctc gatgatgatt gcgtaacaga actttctgta catcacagaa acaacaggca 961 aacaatggag gatttaattt cactgtggca gtatgatcac ctcacggcta cctatcttct 1021 gcttctagcc aagaaggctc ggggaaaacc agttcgttta aggctttctt ctttctcctg 1081 tggacaagcc agtgctaccc cattcacaga catcaagtca aataattgga gtctggaaga 1141 tgtgaccgca agtgataaaa attatgtggc gggattaata gactatgatt ggtgtgaaga 1201 tgatttatca acaggtgctg ctactccccg aacatcacag tttaccaagt actggacaga 1261 atcaaatggg gtggaatcta aatcattaac tccagcctta tgcagaacac ctgcaaataa 1321 attaaagaac aaagaaaatg tatatactcc taagtctgct gtaaagaatg aagagtactt 1381 tatgtttcct gagccaaaga ctccagttaa taagaaccag cataagagag aaatactcac 1441 tacgccaaat cgttacacta caccctcaaa agctagaaac cagtgcctga aagaaactcc 1501 aattaaaata ccagtaaatt caacaggaac agacaagtta atgacaggtg tcattagccc 1561 tgagaggcgg tgccgcTCAG TGGAATTGGA TCTCAACCAA GCACATATGG AGGAGACTCC 1621 AAAAAGAAAG GGAGCCAAAG TGTTTGGGAG CCTTGAAAGG GGGTTGGATA AGGTTATCAC 1681 TGTGCTCACC AGGAGCAAAA GGAAGGGTTC TGCCAGAGAC GGGCCCAGAA GACTAAAGCT 1741 TCACTATAAT GTGACTACAA CTAGATTAGT GAATCCAGAT CAACTGTTGA ATGAAATAAT 1801 GTCTATTCTT CCAAAGAAGC ATGTTGACTT TGTACAAAAG GGTTATACAC TGAAGTGTCA 1861 AACACAGTCA GATTTTGGGA AAGTGACAAT GCAATTTGAA TTAGAAGTGT GCCAGCTTCA 1921 AAACCCGATG TGGTGGGTAT CAGGAGGCAG CGGCTTAAGG GCGATGCCTG GGTTTACAAA 1981 AGATTAGTGG AAGACATCCT ATCTAGCTGT AAGGTATACC CAACTTTCTT GTACAAAGTG 2041 GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA 2101 ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC 2161 GAAGTGTCGA TCCTATACAA AAAACAACGC GTTAAGTCga caatcaacct ctggattaca 2221 aaatttgtga aagatt