Transcript: Human XM_011518079.1

PREDICTED: Homo sapiens maternal embryonic leucine zipper kinase (MELK), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MELK (9833)
Length:
2437
CDS:
137..2092

Additional Resources:

NCBI RefSeq record:
XM_011518079.1
NBCI Gene record:
MELK (9833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001644 CTGAGTTAATACAAGGCAAAT pLKO.1 666 CDS 100% 10.800 15.120 N MELK n/a
2 TRCN0000297346 CTGAGTTAATACAAGGCAAAT pLKO_005 666 CDS 100% 10.800 15.120 N MELK n/a
3 TRCN0000196273 GCGGGATTAATAGACTATGAT pLKO.1 1241 CDS 100% 5.625 7.875 N MELK n/a
4 TRCN0000199147 CGGGTTGTCTTCCGTCAGATA pLKO.1 464 CDS 100% 4.950 6.930 N MELK n/a
5 TRCN0000232391 CTGGAGAGATGGTAGCTATAA pLKO_005 234 CDS 100% 13.200 9.240 N Melk n/a
6 TRCN0000001646 GAACCAGCATAAGAGAGAAAT pLKO.1 1486 CDS 100% 13.200 9.240 N MELK n/a
7 TRCN0000001643 GCCTGAAAGAAACTCCAATTA pLKO.1 1557 CDS 100% 13.200 9.240 N MELK n/a
8 TRCN0000280098 GCCTGAAAGAAACTCCAATTA pLKO_005 1557 CDS 100% 13.200 9.240 N MELK n/a
9 TRCN0000195166 CCTATCTAGCTGCAAGGTATA pLKO.1 2071 CDS 100% 10.800 7.560 N MELK n/a
10 TRCN0000280031 CCTATCTAGCTGCAAGGTATA pLKO_005 2071 CDS 100% 10.800 7.560 N MELK n/a
11 TRCN0000232392 TGGACCCAAAGAAACGGATTT pLKO_005 873 CDS 100% 10.800 7.560 N Melk n/a
12 TRCN0000001645 CAGAAACAACAGGCAAACAAT pLKO.1 1018 CDS 100% 5.625 3.938 N MELK n/a
13 TRCN0000280028 CAGAAACAACAGGCAAACAAT pLKO_005 1018 CDS 100% 5.625 3.938 N MELK n/a
14 TRCN0000196408 GAGAGCTGTTTGACTATATAA pLKO.1 411 CDS 100% 15.000 9.000 N MELK n/a
15 TRCN0000001642 CTCTTAACTATGTCTCTTTGT pLKO.1 2375 3UTR 100% 4.950 2.970 N MELK n/a
16 TRCN0000196420 GACTAAAGCTTCACTATAATG pLKO.1 1803 CDS 100% 13.200 9.240 N MELK n/a
17 TRCN0000280029 GACTAAAGCTTCACTATAATG pLKO_005 1803 CDS 100% 13.200 9.240 N MELK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489883 CATCGCAAGACCACGGGATCAGTT pLX_317 14.3% 99.9% 100% V5 (not translated due to prior stop codon) 1686C>T n/a
2 ccsbBroadEn_14030 pDONR223 100% 99.7% 1% None (many diffs) n/a
3 ccsbBroad304_14030 pLX_304 0% 99.7% 1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000479327 AGTGTCGATCCTATACAAAAAACA pLX_317 22.8% 99.7% 1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV