Transcript: Human NM_001256687.1

Homo sapiens maternal embryonic leucine zipper kinase (MELK), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
MELK (9833)
Length:
2342
CDS:
185..1996

Additional Resources:

NCBI RefSeq record:
NM_001256687.1
NBCI Gene record:
MELK (9833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146713 GCAGCACCTGAGTTAATACA pXPR_003 AGG 395 22% 6 1.1884 MELK MELK 75669
2 BRDN0001145853 CTGTTACGCAATCATCATCG pXPR_003 AGG 704 39% 10 -0.2305 MELK MELK 75668
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256687.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001644 CTGAGTTAATACAAGGCAAAT pLKO.1 570 CDS 100% 10.800 15.120 N MELK n/a
2 TRCN0000297346 CTGAGTTAATACAAGGCAAAT pLKO_005 570 CDS 100% 10.800 15.120 N MELK n/a
3 TRCN0000196273 GCGGGATTAATAGACTATGAT pLKO.1 1145 CDS 100% 5.625 7.875 N MELK n/a
4 TRCN0000232391 CTGGAGAGATGGTAGCTATAA pLKO_005 282 CDS 100% 13.200 9.240 N Melk n/a
5 TRCN0000001646 GAACCAGCATAAGAGAGAAAT pLKO.1 1390 CDS 100% 13.200 9.240 N MELK n/a
6 TRCN0000001643 GCCTGAAAGAAACTCCAATTA pLKO.1 1461 CDS 100% 13.200 9.240 N MELK n/a
7 TRCN0000280098 GCCTGAAAGAAACTCCAATTA pLKO_005 1461 CDS 100% 13.200 9.240 N MELK n/a
8 TRCN0000195166 CCTATCTAGCTGCAAGGTATA pLKO.1 1975 CDS 100% 10.800 7.560 N MELK n/a
9 TRCN0000280031 CCTATCTAGCTGCAAGGTATA pLKO_005 1975 CDS 100% 10.800 7.560 N MELK n/a
10 TRCN0000232392 TGGACCCAAAGAAACGGATTT pLKO_005 777 CDS 100% 10.800 7.560 N Melk n/a
11 TRCN0000001645 CAGAAACAACAGGCAAACAAT pLKO.1 922 CDS 100% 5.625 3.938 N MELK n/a
12 TRCN0000280028 CAGAAACAACAGGCAAACAAT pLKO_005 922 CDS 100% 5.625 3.938 N MELK n/a
13 TRCN0000001642 CTCTTAACTATGTCTCTTTGT pLKO.1 2279 3UTR 100% 4.950 2.970 N MELK n/a
14 TRCN0000196420 GACTAAAGCTTCACTATAATG pLKO.1 1707 CDS 100% 13.200 9.240 N MELK n/a
15 TRCN0000280029 GACTAAAGCTTCACTATAATG pLKO_005 1707 CDS 100% 13.200 9.240 N MELK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256687.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489883 CATCGCAAGACCACGGGATCAGTT pLX_317 14.3% 92.5% 92.6% V5 (not translated due to prior stop codon) 261_262ins144;1542C>T n/a
2 ccsbBroadEn_14030 pDONR223 100% 92.4% 1.1% None (many diffs) n/a
3 ccsbBroad304_14030 pLX_304 0% 92.4% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000479327 AGTGTCGATCCTATACAAAAAACA pLX_317 22.8% 92.4% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV