Construct: ORF TRCN0000479385
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015932.1_s317c1
- Derived from:
- ccsbBroadEn_08800
- DNA Barcode:
- GTACCCGCGCACATGATATCAAGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AASDHPPT (60496)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479385
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 60496 | AASDHPPT | aminoadipate-semialdehyde d... | NM_015423.3 | 99.8% | 100% | 223T>C |
| 2 | human | 60496 | AASDHPPT | aminoadipate-semialdehyde d... | XM_024448641.1 | 48.2% | 43.7% | (many diffs) |
| 3 | mouse | 67618 | Aasdhppt | aminoadipate-semialdehyde d... | NM_026276.3 | 87.5% | 90.9% | (many diffs) |
| 4 | mouse | 67618 | Aasdhppt | aminoadipate-semialdehyde d... | NM_001326359.1 | 71.7% | 74.7% | (many diffs) |
| 5 | mouse | 67618 | Aasdhppt | aminoadipate-semialdehyde d... | XM_006509877.3 | 53.9% | 55.6% | (many diffs) |
| 6 | mouse | 67618 | Aasdhppt | aminoadipate-semialdehyde d... | XM_017313535.1 | 46% | 46.2% | (many diffs) |
| 7 | mouse | 67618 | Aasdhppt | aminoadipate-semialdehyde d... | XM_017313536.1 | 46% | 46.2% | (many diffs) |
| 8 | mouse | 67618 | Aasdhppt | aminoadipate-semialdehyde d... | NR_136940.1 | 27.2% | (many diffs) | |
| 9 | mouse | 67618 | Aasdhppt | aminoadipate-semialdehyde d... | NR_136941.1 | 23.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 993
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tttccctgcc aaacggttct gcttggtgcc atccatggag ggcgtgcgct 121 gggccttttc ctgcggcact tggctgccga gccgagccga atggctgctg gcagtgcgat 181 cgattcagcc cgaggagaag gagcgcattg gccagttcgt ctttgcccgg gacgctaagg 241 cagccatggc tggtcgtctg atgataagga aattagttgc agagaaactg aatatccctt 301 ggaatcatat tcgtttgcaa agaactgcaa aaggaaaacc agttcttgca aaggactcat 361 cgaatcctta cccgaatttc aactttaaca tctctcatca aggagactat gcagtgcttg 421 ctgctgaacc tgagctgcaa gttggaattg atataatgaa gactagtttt ccaggtcgtg 481 gttcaattcc agaattcttt catattatga aaagaaagtt taccaacaaa gaatgggaaa 541 caatcagaag ctttaaggat gagtggactc agctggatat gttttatagg aattgggcac 601 ttaaggaaag cttcataaaa gccattggtg ttggactagg atttgaattg cagcggcttg 661 aatttgatct atctccatta aacttGGATA TAGGCCAAGT TTATAAAGAA ACACGTTTAT 721 TCCTGGATGG AGAGGAAGAA AAAGAATGGG CATTTGAGGA AAGCAAAATA GATGAGCACC 781 ATTTTGTTGC AGTTGCTCTT AGGAAACCCG ATGGATCTAG ACATCAGGAT GTTCCATCTC 841 AGGATGATTC CAAACCAACC CAGAGGCAAT TTACTATTCT CAACTTTAAT GATTTAATGT 901 CATCTGCCGT TCCCATGACA CCTGAAGATC CTTCATTTTG GGACTGTTTT TGCTTCACAG 961 AAGAAATTCC AATACGAAAT GGTACAAAGT CATGCCCAAC TTTCTTGTAC AAAGTGGTTG 1021 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1081 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGT 1141 ACCCGCGCAC ATGATATCAA GGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1201 ttgtgaaaga tt