Transcript: Mouse NR_136941.1

Mus musculus aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase (Aasdhppt), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2016-05-15
Taxon:
Mus musculus (mouse)
Gene:
Aasdhppt (67618)
Length:
2714
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136941.1
NBCI Gene record:
Aasdhppt (67618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_136941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041749 CTTGCGAAAGACTCGTTGAAT pLKO.1 304 3UTR 100% 5.625 7.875 N Aasdhppt n/a
2 TRCN0000041750 GAGGAAGTTTACCATTCTTAA pLKO.1 700 3UTR 100% 13.200 9.240 N Aasdhppt n/a
3 TRCN0000041751 TCTCCATTAAACATGGACATT pLKO.1 509 3UTR 100% 0.495 0.347 N Aasdhppt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03891 pDONR223 100% 23.4% None (many diffs) n/a
2 ccsbBroad304_03891 pLX_304 0% 23.4% V5 (many diffs) n/a
3 TRCN0000474476 CGTTGATTTGAAAGACCTAAAAAC pLX_317 55.3% 23.4% V5 (many diffs) n/a
4 ccsbBroadEn_08800 pDONR223 100% 23.3% None (many diffs) n/a
5 ccsbBroad304_08800 pLX_304 0% 23.3% V5 (many diffs) n/a
6 TRCN0000479385 GTACCCGCGCACATGATATCAAGG pLX_317 33.5% 23.3% V5 (many diffs) n/a
Download CSV