Transcript: Human NM_015423.3

Homo sapiens aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase (AASDHPPT), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
AASDHPPT (60496)
Length:
2767
CDS:
50..979

Additional Resources:

NCBI RefSeq record:
NM_015423.3
NBCI Gene record:
AASDHPPT (60496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015423.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026555 CCATTGGTGTTGGACTAGGAT pLKO.1 606 CDS 100% 3.000 4.200 N AASDHPPT n/a
2 TRCN0000278565 CCATTGGTGTTGGACTAGGAT pLKO_005 606 CDS 100% 3.000 4.200 N AASDHPPT n/a
3 TRCN0000041752 GTCGTGGTTCAATTCCAGAAT pLKO.1 459 CDS 100% 4.950 3.960 N Aasdhppt n/a
4 TRCN0000026516 CGTCTGATGATAAGGAAATTA pLKO.1 239 CDS 100% 15.000 10.500 N AASDHPPT n/a
5 TRCN0000297484 CGTCTGATGATAAGGAAATTA pLKO_005 239 CDS 100% 15.000 10.500 N AASDHPPT n/a
6 TRCN0000026565 GCTGCAAGTTGGAATTGATAT pLKO.1 418 CDS 100% 13.200 9.240 N AASDHPPT n/a
7 TRCN0000278511 GCTGCAAGTTGGAATTGATAT pLKO_005 418 CDS 100% 13.200 9.240 N AASDHPPT n/a
8 TRCN0000026514 CCCGAATTTCAACTTTAACAT pLKO.1 355 CDS 100% 5.625 3.938 N AASDHPPT n/a
9 TRCN0000279590 CCCGAATTTCAACTTTAACAT pLKO_005 355 CDS 100% 5.625 3.938 N AASDHPPT n/a
10 TRCN0000026539 GAGGCAATTTACTATTCTCAA pLKO.1 847 CDS 100% 4.950 3.465 N AASDHPPT n/a
11 TRCN0000278510 GAGGCAATTTACTATTCTCAA pLKO_005 847 CDS 100% 4.950 3.465 N AASDHPPT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015423.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03891 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03891 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474476 CGTTGATTTGAAAGACCTAAAAAC pLX_317 55.3% 100% 100% V5 n/a
4 ccsbBroadEn_08800 pDONR223 100% 99.8% 100% None 223T>C n/a
5 ccsbBroad304_08800 pLX_304 0% 99.8% 100% V5 223T>C n/a
6 TRCN0000479385 GTACCCGCGCACATGATATCAAGG pLX_317 33.5% 99.8% 100% V5 223T>C n/a
Download CSV