Construct: ORF TRCN0000479459
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012415.1_s317c1
- Derived from:
- ccsbBroadEn_11061
- DNA Barcode:
- CAACACTCTTAGGGCCAGCTAGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRSS2 (5645)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479459
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5645 | PRSS2 | serine protease 2 | NM_002770.4 | 96.7% | 96.7% | 718_741del |
2 | human | 5645 | PRSS2 | serine protease 2 | NM_001303414.1 | 91.5% | 91.5% | 201_242del;760_783del |
3 | human | 5646 | PRSS3 | serine protease 3 | NM_002771.3 | 90.3% | 85.4% | (many diffs) |
4 | human | 5644 | PRSS1 | serine protease 1 | NM_002769.5 | 89.8% | 86.6% | (many diffs) |
5 | human | 5646 | PRSS3 | serine protease 3 | NM_001197098.1 | 86.1% | 82.1% | (many diffs) |
6 | human | 5646 | PRSS3 | serine protease 3 | NM_001197097.2 | 83.9% | 77.7% | (many diffs) |
7 | human | 5645 | PRSS2 | serine protease 2 | NR_130149.2 | 79.4% | 1_13del;52_53ins74;657_735del | |
8 | human | 154754 | PRSS3P2 | PRSS3 pseudogene 2 | NR_001296.3 | 77.7% | (many diffs) | |
9 | human | 5646 | PRSS3 | serine protease 3 | NM_007343.3 | 72.4% | 68% | (many diffs) |
10 | human | 5646 | PRSS3 | serine protease 3 | XM_011517965.1 | 65.3% | 60.9% | (many diffs) |
11 | human | 5644 | PRSS1 | serine protease 1 | XM_011516411.1 | 47% | 45.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 783
- ORF length:
- 717
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tctacttctg atccttacct ttgttgcagc tgctgttgct gccccctttg 121 atgatgatga caagatcgtt gggggctaca tctgtgagga gaattctgtc ccctaccagg 181 tgtccttgaa ttctggctac cacttctgcg gtggctccct catcagcgaa cagtgggtgg 241 tgtcagcagg tcactgctac aagtcccgca tccaggtgag actgggagag cacaacatcg 301 aagtcctgga ggggaatgaa cagttcatca atgcggccaa gatcatccgc caccccaaat 361 acaacagccg gactctggac aatgacatcc tgctgatcaa gctctcctca cctgccgtca 421 tcaattcccg cgtgtccgcc atctctctgc ccactgcccc tccagctgct ggcaccgagt 481 ccctcatcTC CGGCTGGGGC AACACTCTGA GTTCTGGTGC CGACTACCCA GACGAGCTGC 541 AGTGCCTGGA TGCTCCTGTG CTGAGCCAGG CTGAGTGTGA AGCCTCCTAC CCTGGAAAGA 601 TTACCAACAA CATGTTCTGT GTGGGCTTCC TCGAGGGAGG CAAGGATTCC TGCCAGGGTG 661 ATTCTGGTGG CCCTGTGGTC TCCAATGGAG AGCTCCAAGG AATTGTCTCC TGGGGCTATG 721 GCTGTGCCCA GAAGAACAGG CCTGGAGTCT ACACCAAGGT CTACAACTAT GTGGACTGGA 781 TTTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 841 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 901 GGCTTTATAT ATCTTGTGGA AAGGACGACA ACACTCTTAG GGCCAGCTAG CCACGCGTTA 961 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt