Construct: ORF TRCN0000479485
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004621.1_s317c1
- Derived from:
- ccsbBroadEn_13892
- DNA Barcode:
- AATTCTTATTAATATCATCTCGCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- LIF (3976)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479485
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3976 | LIF | LIF interleukin 6 family cy... | NM_002309.5 | 99.8% | 4% | 4delA |
| 2 | human | 3976 | LIF | LIF interleukin 6 family cy... | XM_024452239.1 | 99.8% | 4% | 4delA |
| 3 | human | 3976 | LIF | LIF interleukin 6 family cy... | XM_024452240.1 | 99.8% | 4% | 4delA |
| 4 | human | 3976 | LIF | LIF interleukin 6 family cy... | NM_001257135.2 | 43.3% | 10.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 198
- ORF length:
- 132
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gtcttggcgg caggagttgt gcccctgctg ttggttctgc actggaaaca 121 tggggcgggg agccccctcc ccatcacccc tgtcaacgcc acctgtgcca tacgccaccc 181 atgtcacaac aacctcatga accagatcag gagccaactg gcacagctca atggcagtgc 241 caatgccctc tttattctct attacacagc ccagggggag ccgttcccca acaacctgga 301 caagctatgt ggccccaacg tgacggactt cccgcccTTC CACGCCAACG GCACGGAGAA 361 GGCCAAGCTG GTGGAGCTGT ACCGCATAGT CGTGTACCTT GGCACCTCCC TGGGCAACAT 421 CACCCGGGAC CAGAAGATCC TCAACCCCAG TGCCCTCAGC CTCCACAGCA AGCTCAACGC 481 CACCGCCGAC ATCCTGCGAG GCCTCCTTAG CAACGTGCTG TGCCGCCTGT GCAGCAAGTA 541 CCACGTGGGC CATGTGGACG TGACCTACGG CCCTGACACC TCGGGTAAGG ATGTCTTCCA 601 GAAGAAGAAG CTGGGCTGTC AACTCCTGGG GAAGTATAAG CAGATCATCG CCGTGTTGGC 661 CCAGGCCTTC TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA 721 CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC 781 GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAATT CTTATTAATA TCATCTCGCC 841 ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt