Transcript: Human NM_001257135.2

Homo sapiens LIF interleukin 6 family cytokine (LIF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
LIF (3976)
Length:
3692
CDS:
65..331

Additional Resources:

NCBI RefSeq record:
NM_001257135.2
NBCI Gene record:
LIF (3976)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001257135.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308277 ACCGCATAGTCGTGTACCTTG pLKO_005 202 CDS 100% 4.050 5.670 N LIF n/a
2 TRCN0000058585 CGGCCCTGACACCTCGGGTAA pLKO.1 389 3UTR 100% 0.000 0.000 N LIF n/a
3 TRCN0000296724 CAACAACCTGGACAAGCTATG pLKO_005 110 CDS 100% 6.000 4.200 N LIF n/a
4 TRCN0000296662 CTTCTAGCAGGAGGTCTTGAA pLKO_005 488 3UTR 100% 4.950 3.465 N LIF n/a
5 TRCN0000058586 TAAGCAGATCATCGCCGTGTT pLKO.1 458 3UTR 100% 4.050 2.835 N LIF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001257135.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13892 pDONR223 100% 43.3% 10.4% None (many diffs) n/a
2 ccsbBroad304_13892 pLX_304 0% 43.3% 10.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479485 AATTCTTATTAATATCATCTCGCC pLX_317 55% 43.3% 10.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV