Construct: ORF TRCN0000479530
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009260.1_s317c1
- Derived from:
- ccsbBroadEn_02229
- DNA Barcode:
- AACTCGCACTAACCGATCACACTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TRAM2 (9697)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479530
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9697 | TRAM2 | translocation associated me... | NM_012288.4 | 100% | 100% | |
| 2 | human | 9697 | TRAM2 | translocation associated me... | XM_011515005.2 | 85.1% | 81.7% | (many diffs) |
| 3 | mouse | 170829 | Tram2 | translocating chain-associa... | NM_177409.3 | 88.6% | 90% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1176
- ORF length:
- 1110
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tttccgcagg aggacgaaaa gttacccgct cttcagccag gagttcgtca 121 tccacaacca tgcggacatc ggcttctgcc tggtgctctg cgtcctcatc gggcttatgt 181 tcgaggtcac agccaagact gcctttctat ttattttacc tcagtataac attagcgtgc 241 ctacagcaga cagtgagacc gtgcactacc actatggccc taaggacctg gtcacaatct 301 tgttctacat cttcatcacc atcatcttgc atgctgtggt tcaggagtac attttagata 361 aaatcagcaa acggcttcat ctctccaaag tcaaacacag caagttcaat gaatctggac 421 agctggtcgt ctttcatttc acctcggtga tttggtgctt ctacgtggtg gtgacggaag 481 gatacttaac aaacccaaga agcctctggg aagactaccc gcatgtgcac ctccccttcc 541 aggtgaagtt tttctaccta tgccagctgg cctactggct gcacgcactt cctgagctat 601 acttccagaa ggtacggaag gaggaaattc cccgccagct ccagtatatt tgcctgtacc 661 tggtgcatat agctggagca tacctcttaa acctgagccg cctgggcctg atcttgctgc 721 tgctgcagta ctcaactgag ttcctcttcc acacggctag actcttctac tttgcagatg 781 aaaacaacga gaaactgttc agtgcctggg ctgctgtttt tggggttacc cgcctcttca 841 tccTCACCCT TGCCGTGCTG GCCATTGGCT TTGGACTGGC TCGCATGGAA AACCAGGCAT 901 TTGATCCCGA GAAAGGGAAC TTCAACACTT TGTTTTGCAG GCTCTGCGTG CTGCTGCTGG 961 TGTGTGCCGC CCAGGCCTGG CTCATGTGGC GCTTCATCCA CTCCCAGCTG CGGCACTGGC 1021 GGGAATACTG GAATGAGCAG AGTGCAAAGC GGAGAGTCCC AGCCACACCC AGACTACCAG 1081 CCAGGCTCAT CAAGAGGGAA TCTGGTTACC ATGAAAATGG AGTGGTGAAG GCAGAGAACG 1141 GAACCTCCCC ACGGACTAAG AAACTCAAGT CTCCCTACCC AACTTTCTTG TACAAAGTGG 1201 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1261 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1321 AAACTCGCAC TAACCGATCA CACTAACGCG TTAAGTCgac aatcaacctc tggattacaa 1381 aatttgtgaa agatt