Transcript: Human NM_012288.4

Homo sapiens translocation associated membrane protein 2 (TRAM2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TRAM2 (9697)
Length:
7047
CDS:
146..1258

Additional Resources:

NCBI RefSeq record:
NM_012288.4
NBCI Gene record:
TRAM2 (9697)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142331 CGGGTGTGCTAAGGGTTTATT pLKO.1 3883 3UTR 100% 15.000 21.000 N TRAM2 n/a
2 TRCN0000144580 GACGGAAGGATACTTAACAAA pLKO.1 553 CDS 100% 5.625 4.500 N TRAM2 n/a
3 TRCN0000142389 GCTGTGGTTCAGGAGTACATT pLKO.1 413 CDS 100% 5.625 3.938 N TRAM2 n/a
4 TRCN0000122746 CCCACGGACTAAGAAACTCAA pLKO.1 1228 CDS 100% 4.950 3.465 N TRAM2 n/a
5 TRCN0000141247 CTCGGTGATTTGGTGCTTCTA pLKO.1 523 CDS 100% 4.950 3.465 N TRAM2 n/a
6 TRCN0000144950 GAAAGGGAACTTCAACACTTT pLKO.1 991 CDS 100% 4.950 3.465 N TRAM2 n/a
7 TRCN0000143429 GAGCTATACTTCCAGAAGGTA pLKO.1 674 CDS 100% 3.000 2.100 N TRAM2 n/a
8 TRCN0000141770 GAGTTCGTCATCCACAACCAT pLKO.1 191 CDS 100% 3.000 2.100 N TRAM2 n/a
9 TRCN0000141843 GCAGTAGCTTACGCCTGTTAT pLKO.1 2620 3UTR 100% 13.200 7.920 N TRAM2 n/a
10 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2795 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02229 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02229 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479530 AACTCGCACTAACCGATCACACTA pLX_317 30.3% 100% 100% V5 n/a
Download CSV