Transcript: Mouse NM_177409.3

Mus musculus translocating chain-associating membrane protein 2 (Tram2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tram2 (170829)
Length:
1390
CDS:
113..1225

Additional Resources:

NCBI RefSeq record:
NM_177409.3
NBCI Gene record:
Tram2 (170829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177409.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125642 GTGATCGTAACAGAAGGATAT pLKO.1 512 CDS 100% 10.800 15.120 N Tram2 n/a
2 TRCN0000125643 CCTCAAGAGAGAACCTGGTTA pLKO.1 1135 CDS 100% 4.950 3.465 N Tram2 n/a
3 TRCN0000125640 GCTGCAATACATTTGTCTGTA pLKO.1 685 CDS 100% 4.950 3.465 N Tram2 n/a
4 TRCN0000125641 CCAGGAGTACATCTTAGACAA pLKO.1 388 CDS 100% 4.950 2.970 N Tram2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177409.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02229 pDONR223 100% 88.6% 90% None (many diffs) n/a
2 ccsbBroad304_02229 pLX_304 0% 88.6% 90% V5 (many diffs) n/a
3 TRCN0000479530 AACTCGCACTAACCGATCACACTA pLX_317 30.3% 88.6% 90% V5 (many diffs) n/a
Download CSV