Construct: ORF TRCN0000479574
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015432.1_s317c1
- Derived from:
- ccsbBroadEn_10055
- DNA Barcode:
- CTCGTGCCCCACACCAATCATTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRTM1 (347730)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479574
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 347730 | LRRTM1 | leucine rich repeat transme... | NM_178839.5 | 99.9% | 99.8% | 989A>G |
| 2 | human | 347730 | LRRTM1 | leucine rich repeat transme... | XM_017003986.2 | 99.9% | 99.8% | 989A>G |
| 3 | human | 347730 | LRRTM1 | leucine rich repeat transme... | XM_017003987.2 | 99.9% | 99.8% | 989A>G |
| 4 | mouse | 74342 | Lrrtm1 | leucine rich repeat transme... | NM_028880.3 | 91.9% | 97.1% | (many diffs) |
| 5 | mouse | 74342 | Lrrtm1 | leucine rich repeat transme... | XM_006506712.1 | 91.9% | 97.1% | (many diffs) |
| 6 | mouse | 74342 | Lrrtm1 | leucine rich repeat transme... | XR_377498.2 | 27.2% | (many diffs) | |
| 7 | mouse | 74342 | Lrrtm1 | leucine rich repeat transme... | XR_001785179.1 | 27.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1632
- ORF length:
- 1566
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tttcctgctg ctcggtctct gtctatactg gctgctgagg aggccctcgg 121 gggtggtctt gtgtctgctg ggggcctgct ttcagatgct gcccgccgcc cccagcgggt 181 gcccgcagct gtgccggtgc gaggggcggc tgctgtactg cgaggcgctc aacctcaccg 241 aggcgcccca caacctgtcc ggcctgctgg gcttgtccct gcgctacaac agcctctcgg 301 agctgcgcgc cggccagttc acggggttaa tgcagctcac gtggctctat ctggatcaca 361 atcacatctg ctccgtgcag ggggacgcct ttcagaaact gcgccgagtt aaggaactca 421 cgctgagttc caaccagatc acccaactgc ccaacaccac cttccggccc atgcccaacc 481 tgcgcagcgt ggacctctcg tacaacaagc tgcaggcgct cgcgcccgac ctcttccacg 541 ggctgcggaa gctcaccacg ctgcatatgc gggccaacgc catccagttt gtgcccgtgc 601 gcatcttcca ggactgccgc agcctcaagt ttctcgacat cggatacaat cagctcaaga 661 gtctggcgcg caactctttc gccggcttgt ttaagctcac cgagctgcac ctcgagcaca 721 acgacttggt caaggtgaac ttcgcccact tcccgcgcct catctccctg cactcgctct 781 gcctgcggag gaacaaggtg gccattgtgg tcagctcgct ggactgggtt tggaacctgg 841 agaaaatgga cttgtcgggc aacgagatcg agtacatgga gccccatgtg ttcgagaccg 901 tgccgcacct gcagtccctg cagctggact ccaaccgcct cacctacatc gagccccgga 961 tcctcaactc ttggaagtcc ctgacaagca tcaccctggc cgggaacctg tgggattgcg 1021 ggcgcaacgt gtgtgcccta gcctcgtggc tcagcaactt ccaggggcgc tacgatggca 1081 acttgcagtg cgccagcccg gagtacgcac agggcgagga cgtcctggac gccgtgtacg 1141 ccttccacct gtgcgaggat ggggccgagc ccaccagcgg ccacctgctc tcggccgtca 1201 ccaaccgcag tgatctgggg ccccctgcca gctcggccac cacgctcgcg gacggcgggG 1261 AGGGGCAGCA CGACGGCACA TTCGAGCCTG CCACCGTGGC TCTTCCAGGC GGCGAGCACG 1321 CCGAGAACGC CGTGCAGATC CACAAGGTGG TCACGGGCAC CATGGCCCTC ATCTTCTCCT 1381 TCCTCATCGT GGTCCTGGTG CTCTACGTGT CCTGGAAGTG TTTCCCAGCC AGCCTCAGGC 1441 AGCTCAGACA GTGCTTTGTC ACGCAGCGCA GGAAGCAAAA GCAGAAACAG ACCATGCATC 1501 AGATGGCTGC CATGTCTGCC CAGGAATACT ACGTTGATTA CAAACCGAAC CACATTGAGG 1561 GAGCCCTGGT GATCATCAAC GAGTATGGCT CGTGTACCTG CCACCAGCAG CCCGCGAGGG 1621 AATGCGAGGT GTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1681 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1741 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTC GTGCCCCACA CCAATCATTA 1801 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t