Transcript: Mouse XR_001785179.1

PREDICTED: Mus musculus leucine rich repeat transmembrane neuronal 1 (Lrrtm1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrtm1 (74342)
Length:
5295
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785179.1
NBCI Gene record:
Lrrtm1 (74342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439137 AGGGAATGCGAGGTGTGATTG pLKO_005 2358 3UTR 100% 10.800 15.120 N LRRTM1 n/a
2 TRCN0000106507 CCGTATTCTCAACTCCTGGAA pLKO.1 1697 3UTR 100% 2.640 3.696 N Lrrtm1 n/a
3 TRCN0000106505 CGCTCTGATTTGTTGACTGAA pLKO.1 2462 3UTR 100% 4.950 3.465 N Lrrtm1 n/a
4 TRCN0000106508 CAGCCTCAAGTTTCTCGACAT pLKO.1 1361 3UTR 100% 4.050 2.835 N Lrrtm1 n/a
5 TRCN0000158238 CAGCCTCAAGTTTCTCGACAT pLKO.1 1361 3UTR 100% 4.050 2.835 N LRRTM1 n/a
6 TRCN0000106506 CCTGGTTATCATCAACGAGTA pLKO.1 2306 3UTR 100% 4.050 2.835 N Lrrtm1 n/a
7 TRCN0000157677 GTTAAGGAACTCACGCTGAGT pLKO.1 1149 3UTR 100% 2.640 1.848 N LRRTM1 n/a
8 TRCN0000106509 TGGCTGTATTTGGATCACAAT pLKO.1 1083 3UTR 100% 4.950 2.970 N Lrrtm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10055 pDONR223 100% 27.2% None (many diffs) n/a
2 ccsbBroad304_10055 pLX_304 0% 27.2% V5 (many diffs) n/a
3 TRCN0000479574 CTCGTGCCCCACACCAATCATTAA pLX_317 24.1% 27.2% V5 (many diffs) n/a
Download CSV