Transcript: Human NM_178839.5

Homo sapiens leucine rich repeat transmembrane neuronal 1 (LRRTM1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
LRRTM1 (347730)
Length:
2602
CDS:
661..2229

Additional Resources:

NCBI RefSeq record:
NM_178839.5
NBCI Gene record:
LRRTM1 (347730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178839.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152266 CCAGGAATACTACGTTGATTA pLKO.1 2115 CDS 100% 13.200 18.480 N LRRTM1 n/a
2 TRCN0000156501 CGACTTGGTCAAGGTGAACTT pLKO.1 1317 CDS 100% 4.950 6.930 N LRRTM1 n/a
3 TRCN0000154245 CATCGGATACAATCAGCTCAA pLKO.1 1233 CDS 100% 4.050 3.240 N LRRTM1 n/a
4 TRCN0000152121 CTACGTTGATTACAAACCGAA pLKO.1 2124 CDS 100% 2.640 2.112 N LRRTM1 n/a
5 TRCN0000439137 AGGGAATGCGAGGTGTGATTG pLKO_005 2212 CDS 100% 10.800 7.560 N LRRTM1 n/a
6 TRCN0000415031 GATATGCTCCTTGACTGAAAC pLKO_005 2327 3UTR 100% 10.800 7.560 N LRRTM1 n/a
7 TRCN0000422841 GGCTCTATCTGGATCACAATC pLKO_005 938 CDS 100% 10.800 7.560 N LRRTM1 n/a
8 TRCN0000416730 TACGTGTCCTGGAAGTGTTTC pLKO_005 1999 CDS 100% 10.800 7.560 N LRRTM1 n/a
9 TRCN0000153635 CTGGTGATCATCAACGAGTAT pLKO.1 2161 CDS 100% 4.950 3.465 N LRRTM1 n/a
10 TRCN0000106508 CAGCCTCAAGTTTCTCGACAT pLKO.1 1215 CDS 100% 4.050 2.835 N Lrrtm1 n/a
11 TRCN0000158238 CAGCCTCAAGTTTCTCGACAT pLKO.1 1215 CDS 100% 4.050 2.835 N LRRTM1 n/a
12 TRCN0000157677 GTTAAGGAACTCACGCTGAGT pLKO.1 1003 CDS 100% 2.640 1.848 N LRRTM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178839.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10055 pDONR223 100% 99.9% 99.8% None 989A>G n/a
2 ccsbBroad304_10055 pLX_304 0% 99.9% 99.8% V5 989A>G n/a
3 TRCN0000479574 CTCGTGCCCCACACCAATCATTAA pLX_317 24.1% 99.9% 99.8% V5 989A>G n/a
Download CSV