Construct: ORF TRCN0000479631
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006625.1_s317c1
- Derived from:
- ccsbBroadEn_12455
- DNA Barcode:
- TATATCCGGCGAGCAATGCCGGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPATA1 (100505741)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479631
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542522.2 | 83.6% | 82.4% | (many diffs) |
| 2 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542519.2 | 75.8% | 74.6% | (many diffs) |
| 3 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542516.1 | 73.7% | 72.5% | (many diffs) |
| 4 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542517.1 | 73.7% | 72.5% | (many diffs) |
| 5 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542515.2 | 72% | 70.7% | (many diffs) |
| 6 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XR_947545.1 | 57.5% | (many diffs) | |
| 7 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_011542514.2 | 50.5% | 49.4% | (many diffs) |
| 8 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XM_024446289.1 | 45.9% | 44.8% | (many diffs) |
| 9 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | NM_001310156.2 | 41.1% | 40% | (many diffs) |
| 10 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XR_002956255.1 | 25.3% | (many diffs) | |
| 11 | human | 100505741 | SPATA1 | spermatogenesis associated 1 | XR_002956254.1 | 25.3% | (many diffs) | |
| 12 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_006502095.3 | 64.6% | 57.4% | (many diffs) |
| 13 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_017319723.1 | 43.2% | 38.2% | (many diffs) |
| 14 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_011240231.2 | 41.9% | 37.1% | (many diffs) |
| 15 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_011240230.2 | 39.9% | 35.2% | (many diffs) |
| 16 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_006502092.3 | 39.1% | 34.5% | (many diffs) |
| 17 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_011240229.2 | 38% | 33.6% | (many diffs) |
| 18 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | NM_001316756.1 | 36.3% | 32.1% | (many diffs) |
| 19 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | NM_027617.3 | 36.3% | 32.1% | (many diffs) |
| 20 | mouse | 70951 | Spata1 | spermatogenesis associated 1 | XM_006502090.3 | 36.3% | 32.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 726
- ORF length:
- 660
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gaaagataaa aaaagaaaca aaattccaat tgataattat cccattcaga 121 cattagtgaa tatgtcactc aatccaagtc gaccttcctc atcagagttg gtggaacttc 181 atgtttttta tgtccctgaa ggatcatgga actataagct aaataccatt tcaacagaag 241 ttgttaacaa attcatttca gctggatttc taagagtatc tcctcaactt actttacgag 301 ccctgaggga gcgtcttggt gagttcctgg gtgaagatgc tattgcagaa aaatttttat 361 ttctgaaatg cattggaaat aatttagctg tggtgaagga aaagcaagaa tcagaactga 421 aactcaaatc atttgctcct ccatatgctc ttcaaccaga attatatttg cttcctgtaa 481 tggaCCATTT AGGAAATGTT TATTCACCAT CAACAGTTAT TTTAGATGAG CGGCAGACTA 541 ATAATGGTGT TAATGAGGCT GATGGAACAA TCCACAGACC AATTAGTGTA ACTTTGTTCA 601 AGGAGGAACT TGGAAGAGAT CCCAGTTTGT TAGAAAACAC TTTGAAAGAG CTTCCTAACA 661 AGAATCAGGA AGAAGGTGAT TTTAAACTGG AATGGGAAAA AGAAAGAGGC TATTATAGTA 721 CATTTTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 781 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 841 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATATATCCGG CGAGCAATGC CGGCCACGCG 901 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt