Transcript: Mouse XM_011240230.2

PREDICTED: Mus musculus spermatogenesis associated 1 (Spata1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata1 (70951)
Length:
1852
CDS:
308..1516

Additional Resources:

NCBI RefSeq record:
XM_011240230.2
NBCI Gene record:
Spata1 (70951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181705 GCACGCAATTGACCAACTTAA pLKO.1 1339 CDS 100% 13.200 18.480 N Spata1 n/a
2 TRCN0000198908 GCTCATCGTAAGACATCACAA pLKO.1 1608 3UTR 100% 4.950 6.930 N Spata1 n/a
3 TRCN0000198140 CCTGTAATAGATCACTTAGGA pLKO.1 650 CDS 100% 3.000 4.200 N Spata1 n/a
4 TRCN0000181795 GCTGATCTGACACAGAAGAAA pLKO.1 1445 CDS 100% 5.625 3.938 N Spata1 n/a
5 TRCN0000198996 GATCTGACTTTGCTCATCGTA pLKO.1 1597 3UTR 100% 3.000 2.100 N Spata1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12455 pDONR223 100% 39.9% 35.2% None (many diffs) n/a
2 ccsbBroad304_12455 pLX_304 0% 39.9% 35.2% V5 (many diffs) n/a
3 TRCN0000479631 TATATCCGGCGAGCAATGCCGGCC pLX_317 37% 39.9% 35.2% V5 (many diffs) n/a
Download CSV