Construct: ORF TRCN0000479768
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015474.1_s317c1
- Derived from:
- ccsbBroadEn_01847
- DNA Barcode:
- TGCGCACGATATTATTTTTACCTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TFEB (7942)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479768
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7942 | TFEB | transcription factor EB | NM_001271944.2 | 100% | 100% | |
2 | human | 7942 | TFEB | transcription factor EB | NM_001271945.1 | 100% | 100% | |
3 | human | 7942 | TFEB | transcription factor EB | NM_007162.2 | 100% | 100% | |
4 | human | 7942 | TFEB | transcription factor EB | XM_005249411.1 | 100% | 100% | |
5 | human | 7942 | TFEB | transcription factor EB | XM_005249412.1 | 100% | 100% | |
6 | human | 7942 | TFEB | transcription factor EB | XM_006715212.4 | 100% | 100% | |
7 | human | 7942 | TFEB | transcription factor EB | XM_011514915.1 | 100% | 100% | |
8 | human | 7942 | TFEB | transcription factor EB | XM_011514916.2 | 100% | 100% | |
9 | human | 7942 | TFEB | transcription factor EB | NM_001167827.3 | 97.1% | 97.1% | 1_42del |
10 | human | 7942 | TFEB | transcription factor EB | NM_001271943.1 | 82.1% | 82.1% | 211_212ins255 |
11 | mouse | 21425 | Tfeb | transcription factor EB | NM_001161722.1 | 89% | 93.4% | (many diffs) |
12 | mouse | 21425 | Tfeb | transcription factor EB | NM_001161723.1 | 89% | 93.4% | (many diffs) |
13 | mouse | 21425 | Tfeb | transcription factor EB | XM_006524003.3 | 89% | 93.4% | (many diffs) |
14 | mouse | 21425 | Tfeb | transcription factor EB | XM_006524006.3 | 89% | 93.4% | (many diffs) |
15 | mouse | 21425 | Tfeb | transcription factor EB | XM_006524007.3 | 89% | 93.4% | (many diffs) |
16 | mouse | 21425 | Tfeb | transcription factor EB | XM_006524004.1 | 82.9% | 87% | (many diffs) |
17 | mouse | 21425 | Tfeb | transcription factor EB | NM_011549.3 | 79.1% | 83.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1494
- ORF length:
- 1428
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtcacgcata gggttgcgca tgcagctcat gcgggagcag gcgcagcagg 121 aggagcagcg ggagcgcatg cagcaacagg ctgtcatgca ttacatgcag cagcagcagc 181 agcagcaaca gcagcagctc ggagggccgc ccaccccggc catcaatacc cccgtccact 241 tccagtcgcc accacctgtg cctggggagg tgttgaaggt gcagtcctac ctggagaatc 301 ccacatccta ccatctgcag cagtcgcagc atcagaaggt gcgggagtac ctgtccgaga 361 cctatgggaa caagtttgct gcccacatca gcccagccca gggctctccg aaacccccac 421 cagccgcctc cccaggggtg cgagctggac acgtgctgtc ctcctccgct ggcaacagtg 481 ctcccaatag ccccatggcc atgctgcaca ttggctccaa ccctgagagg gagttggatg 541 atgtcattga caacattatg cgtctggacg atgtccttgg ctacatcaat cctgaaatgc 601 agatgcccaa cacgctaccc ctgtccagca gccacctgaa tgtgtacagc agcgaccccc 661 aggtcacagc ctccctggtg ggcgtcacca gcagctcctg ccctgcggac ctgacccaga 721 agcgagagct cacagatgct gagagcaggg ccctggccaa ggagcggcag aagaaagaca 781 atcacaactt aattgaaagg agacgaaggt tcaacatcaa tgaccgcatc aaggagttgg 841 gaatgctgat ccccaaggcc aatgacctgg acgtgcgctg gaacaagggc accatcctca 901 aggcctctgt ggattacatc cggaggatgc agaaggacct gcaaaagtcc agggagctgg 961 agaaccactc tcgccgcctg gagatgacca acaagcagct ctggctccgt atccaggagc 1021 tggagatgca ggctcgagtg cacggcctcc ctaccacctc cccgtccggc atgaacatgg 1081 ctgagctggc ccagcaggtg gtgaagcagg agctgcctag cgaagagggc ccaggggagg 1141 ccctgatgct gggggctgag gtccctgacc cTGAGCCACT GCCAGCTCTG CCCCCGCAAG 1201 CCCCGCTGCC CCTGCCCACC CAGCCACCAT CCCCATTCCA TCACCTGGAC TTCAGCCACA 1261 GCCTGAGCTT TGGGGGCAGG GAGGACGAGG GTCCCCCGGG CTACCCCGAA CCCCTGGCGC 1321 CGGGGCATGG CTCCCCATTC CCCAGCCTGT CCAAGAAGGA TCTGGACCTC ATGCTCCTGG 1381 ACGACTCACT GCTACCGCTG GCCTCTGATC CACTTCTGTC CACCATGTCC CCCGAGGCCT 1441 CCAAGGCCAG CAGCCGCCGG AGCAGCTTCA GCATGGAGGA GGGCGATGTG CTGTGCCCAA 1501 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1561 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1621 TATCTTGTGG AAAGGACGAT GCGCACGATA TTATTTTTAC CTTACGCGTT AAGTCgacaa 1681 tcaacctctg gattacaaaa tttgtgaaag att