Transcript: Human NM_007162.2

Homo sapiens transcription factor EB (TFEB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TFEB (7942)
Length:
2364
CDS:
303..1733

Additional Resources:

NCBI RefSeq record:
NM_007162.2
NBCI Gene record:
TFEB (7942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435179 AGACCTATGGGAACAAGTTTG pLKO_005 595 CDS 100% 10.800 8.640 N Tfeb n/a
2 TRCN0000013110 GAGACGAAGGTTCAACATCAA pLKO.1 1037 CDS 100% 4.950 3.960 N TFEB n/a
3 TRCN0000013109 CGATGTCCTTGGCTACATCAA pLKO.1 806 CDS 100% 0.495 0.396 N TFEB n/a
4 TRCN0000413524 GGGAGTTGGATGATGTCATTG pLKO_005 766 CDS 100% 10.800 7.560 N TFEB n/a
5 TRCN0000440038 TGGCAACAGTGCTCCCAATAG pLKO_005 707 CDS 100% 10.800 7.560 N TFEB n/a
6 TRCN0000437246 AGTACCTGTCCGAGACCTATG pLKO_005 583 CDS 100% 6.000 4.200 N TFEB n/a
7 TRCN0000013111 GAACAAGTTTGCTGCCCACAT pLKO.1 605 CDS 100% 4.050 2.835 N TFEB n/a
8 TRCN0000437429 GTGGATTACATCCGGAGGATG pLKO_005 1146 CDS 100% 4.050 2.835 N TFEB n/a
9 TRCN0000013108 CCCACTTTGGTGCTAATAGCT pLKO.1 2220 3UTR 100% 3.000 2.100 N TFEB n/a
10 TRCN0000013112 TGATCCACTTCTGTCCACCAT pLKO.1 1643 CDS 100% 2.640 1.848 N TFEB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01847 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01847 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479768 TGCGCACGATATTATTTTTACCTT pLX_317 22.9% 100% 100% V5 n/a
Download CSV