Transcript: Mouse NM_001161723.1

Mus musculus transcription factor EB (Tfeb), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tfeb (21425)
Length:
2351
CDS:
297..1724

Additional Resources:

NCBI RefSeq record:
NM_001161723.1
NBCI Gene record:
Tfeb (21425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431646 GACGCAGGTTCAACATCAATG pLKO_005 1030 CDS 100% 10.800 8.640 N Tfeb n/a
2 TRCN0000085550 GCAGGCTGTCATGCATTATAT pLKO.1 377 CDS 100% 15.000 10.500 N Tfeb n/a
3 TRCN0000085549 CCAAGAAGGATCTGGACTTAA pLKO.1 1579 CDS 100% 13.200 9.240 N Tfeb n/a
4 TRCN0000435179 AGACCTATGGGAACAAGTTTG pLKO_005 586 CDS 100% 10.800 7.560 N Tfeb n/a
5 TRCN0000085548 CGGCAGTACTATGACTATGAT pLKO.1 1947 3UTR 100% 5.625 3.938 N Tfeb n/a
6 TRCN0000437429 GTGGATTACATCCGGAGGATG pLKO_005 1137 CDS 100% 4.050 2.835 N TFEB n/a
7 TRCN0000013111 GAACAAGTTTGCTGCCCACAT pLKO.1 596 CDS 100% 4.050 5.670 N TFEB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01847 pDONR223 100% 89% 93.4% None (many diffs) n/a
2 ccsbBroad304_01847 pLX_304 0% 89% 93.4% V5 (many diffs) n/a
3 TRCN0000479768 TGCGCACGATATTATTTTTACCTT pLX_317 22.9% 89% 93.4% V5 (many diffs) n/a
Download CSV