Construct: ORF TRCN0000479772
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012390.1_s317c1
- Derived from:
- ccsbBroadEn_09342
- DNA Barcode:
- AGGCAATCGTACGATGCCATACCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FANK1 (92565)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479772
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 92565 | FANK1 | fibronectin type III and an... | NM_145235.5 | 99.9% | 99.7% | 14A>G |
2 | human | 92565 | FANK1 | fibronectin type III and an... | NM_001363549.1 | 98.2% | 98.2% | 0_1insATGGAGCCCCAGAGAATC |
3 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016921.2 | 98.2% | 98.2% | 0_1insATGGAGCCCCAGAGAATC |
4 | human | 92565 | FANK1 | fibronectin type III and an... | XM_024448252.1 | 96.8% | 95.7% | (many diffs) |
5 | human | 92565 | FANK1 | fibronectin type III and an... | XM_006718064.3 | 96.5% | 96.2% | 0_1insATGGAGCCCCAGAGAATC;299_316del |
6 | human | 92565 | FANK1 | fibronectin type III and an... | XM_024448253.1 | 96.5% | 96.2% | 0_1insATGGAGCCCCAGAGAATC;299_316del |
7 | human | 92565 | FANK1 | fibronectin type III and an... | XM_006718058.4 | 95.2% | 93.9% | (many diffs) |
8 | human | 92565 | FANK1 | fibronectin type III and an... | NM_001350939.1 | 92.9% | 92.7% | 14A>G;317_394del |
9 | human | 92565 | FANK1 | fibronectin type III and an... | XM_011540349.3 | 91.9% | 91.3% | (many diffs) |
10 | human | 92565 | FANK1 | fibronectin type III and an... | XM_024448258.1 | 91.8% | 91.8% | 0_1insATGGAGCCCCAGAGAATC;452_453ins66 |
11 | human | 92565 | FANK1 | fibronectin type III and an... | XM_011540351.2 | 91.3% | 91.3% | 0_1insATGGAGCCCCAGAGAATC;299_376del |
12 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016917.2 | 91.3% | 91.3% | 0_1insATGGAGCCCCAGAGAATC;299_376del |
13 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016918.1 | 91.3% | 91.3% | 0_1insATGGAGCCCCAGAGAATC;299_376del |
14 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016919.1 | 91.3% | 91.3% | 0_1insATGGAGCCCCAGAGAATC;299_376del |
15 | human | 92565 | FANK1 | fibronectin type III and an... | XM_024448256.1 | 90.3% | 90% | 0_1insATGGAGCCCCAGAGAATC;299_316del;470_471ins66 |
16 | human | 92565 | FANK1 | fibronectin type III and an... | XM_024448257.1 | 90.3% | 90% | 0_1insATGGAGCCCCAGAGAATC;299_316del;470_471ins66 |
17 | human | 92565 | FANK1 | fibronectin type III and an... | XM_011540348.2 | 90.2% | 89.2% | (many diffs) |
18 | human | 92565 | FANK1 | fibronectin type III and an... | XM_024448251.1 | 90.2% | 89.2% | (many diffs) |
19 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016923.2 | 88% | 87.8% | 14A>G;848_849ins123 |
20 | human | 92565 | FANK1 | fibronectin type III and an... | XM_011540358.3 | 85.2% | 84.2% | (many diffs) |
21 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016920.2 | 84.4% | 83.4% | (many diffs) |
22 | human | 92565 | FANK1 | fibronectin type III and an... | XM_024448254.1 | 79.4% | 78.4% | (many diffs) |
23 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016922.2 | 76.9% | 76% | (many diffs) |
24 | human | 92565 | FANK1 | fibronectin type III and an... | XM_011540360.3 | 71.9% | 70.2% | (many diffs) |
25 | human | 92565 | FANK1 | fibronectin type III and an... | XM_011540361.2 | 71.9% | 70.2% | (many diffs) |
26 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016924.1 | 71.9% | 70.2% | (many diffs) |
27 | human | 92565 | FANK1 | fibronectin type III and an... | XM_005270280.4 | 57.1% | 57.1% | 0_1ins444 |
28 | human | 92565 | FANK1 | fibronectin type III and an... | XM_011540362.3 | 57.1% | 57.1% | 0_1ins444 |
29 | human | 92565 | FANK1 | fibronectin type III and an... | XM_017016926.1 | 57.1% | 57.1% | 0_1ins444 |
30 | human | 92565 | FANK1 | fibronectin type III and an... | XR_945878.3 | 50.6% | (many diffs) | |
31 | human | 92565 | FANK1 | fibronectin type III and an... | XM_011540363.3 | 41.1% | 40.1% | (many diffs) |
32 | mouse | 66930 | Fank1 | fibronectin type 3 and anky... | NM_025850.2 | 85.7% | 88.1% | (many diffs) |
33 | mouse | 66930 | Fank1 | fibronectin type 3 and anky... | XM_006508120.2 | 79.8% | 81.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1101
- ORF length:
- 1035
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gccccagaga atcatgccac cctcaaagcc tcatccacct gtcgtgggca 121 aagtgactca tcacagcatt gaattatact gggatctgga aaagaaagcc aaacgccaag 181 gacctcaaga gcagtggttc aggttctcga ttgaagaaga agaccccaaa atgcacactt 241 atggtatcat ttatacggga tatgcaacga agcatgttgt tgaaggtctg gaaccaagga 301 cgctgtacag atttcgcctg aaggtcacca gcccctctgg ggagtgtgag tacagcccac 361 tcgtctcagt gtctacaacc agagagccca taagtagtga gcacttgcac cgggctgtca 421 gtgtgaatga tgaagatttg ctggtccgaa tacttcaagg aggccgtgtt aaggttgatg 481 ttcccaataa gtttggcttt accgctctga tggttgctgc ccagaaagga tacaccaggc 541 ttgtgaaaat cctagtttct aatggcacag acgtgaatct gaagaatgga agtggcaagg 601 acagtctaat gctggcgtgc tatgcgggac acctagatgt tgtgaaatat ctccgaagac 661 atggcgcttc ttggcaggct agagacctgg gaggctgtac agctctgcac tgggctgcag 721 atggaggcca ctgcagtgtg attgagtgGA TGATAAAGGA TGGCTGTGAG GTAGACGTCG 781 TGGACACTGG TTCAGGATGG ACCCCACTCA TGAGAGTCTC TGCGGTGTCG GGAAATCAGA 841 GGGTGGCCTC TCTTCTAATT GATGCTGGGG CCAATGTGAA TGTGAAGGAC AGAAATGGAA 901 AGACGCCCCT TATGGTGGCT GTGTTAAATA ATCATGAAGA GTTAGTTCAG TTACTTCTTG 961 ACAAAGGGGC AGATGCAAGT GTAAAAAATG AGTTCGGCAA AGGTGTCCTA GAAATGGCCA 1021 GAGTTTTTGA CAGACAGAGT GTAGTCTCCT TATTAGAAGA AAGGAAAAAA AAGCAGAGGC 1081 CAAAGAAGTC TTGTGTCTGC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1141 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1201 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGGC AATCGTACGA 1261 TGCCATACCT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt