Transcript: Human XM_024448258.1

PREDICTED: Homo sapiens fibronectin type III and ankyrin repeat domains 1 (FANK1), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FANK1 (92565)
Length:
1223
CDS:
109..1062

Additional Resources:

NCBI RefSeq record:
XM_024448258.1
NBCI Gene record:
FANK1 (92565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172667 GCTGTACAGATTTCGCCTGAA pLKO.1 327 CDS 100% 4.050 3.240 N FANK1 n/a
2 TRCN0000440993 GAGGGTGGCCTCTCTTCTAAT pLKO_005 798 CDS 100% 13.200 9.240 N FANK1 n/a
3 TRCN0000167612 GCACACTTATGGTATCATTTA pLKO.1 258 CDS 100% 13.200 9.240 N FANK1 n/a
4 TRCN0000167422 GTAGTCTCCTTATTAGAAGAA pLKO.1 1000 CDS 100% 4.950 3.465 N FANK1 n/a
5 TRCN0000167539 GTTCAGTTACTTCTTGACAAA pLKO.1 904 CDS 100% 4.950 3.465 N FANK1 n/a
6 TRCN0000172515 CCGTGACTGTTAAACTAGGGA pLKO.1 1107 3UTR 100% 0.750 0.525 N FANK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09342 pDONR223 100% 91.8% 91.8% None 0_1insATGGAGCCCCAGAGAATC;452_453ins66 n/a
2 ccsbBroad304_09342 pLX_304 0% 91.8% 91.8% V5 0_1insATGGAGCCCCAGAGAATC;452_453ins66 n/a
3 TRCN0000479772 AGGCAATCGTACGATGCCATACCT pLX_317 34.4% 91.8% 91.8% V5 0_1insATGGAGCCCCAGAGAATC;452_453ins66 n/a
Download CSV