Construct: ORF TRCN0000479814
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011967.1_s317c1
- Derived from:
- ccsbBroadEn_03484
- DNA Barcode:
- TGAGAATATTCACCACGAAGATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CHCHD3 (54927)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479814
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54927 | CHCHD3 | coiled-coil-helix-coiled-co... | NM_017812.4 | 100% | 100% | |
| 2 | human | 54927 | CHCHD3 | coiled-coil-helix-coiled-co... | NM_001317177.1 | 97.8% | 97.8% | 370_384del |
| 3 | human | 54927 | CHCHD3 | coiled-coil-helix-coiled-co... | NM_001317178.1 | 55.2% | 55.4% | (many diffs) |
| 4 | human | 54927 | CHCHD3 | coiled-coil-helix-coiled-co... | NR_133671.1 | 32.6% | (many diffs) | |
| 5 | mouse | 66075 | Chchd3 | coiled-coil-helix-coiled-co... | NM_025336.1 | 87.5% | 90.3% | (many diffs) |
| 6 | mouse | 66075 | Chchd3 | coiled-coil-helix-coiled-co... | XM_006506467.3 | 85.6% | 88.3% | (many diffs) |
| 7 | mouse | 66075 | Chchd3 | coiled-coil-helix-coiled-co... | XM_006506468.3 | 56.5% | 59% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 747
- ORF length:
- 681
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tgggaccacc agcacccgcc gggtcacctt cgaggcggac gagaatgaga 121 acatcaccgt ggtgaagggc atccggcttt cggaaaatgt gattgatcga atgaaggaat 181 cctctccatc tggttcgaag tctcagcggt attctggtgc ttatggtgcc tcagtttctg 241 atgaagaatt gaaaagaaga gtagctgagg agctggcatt ggagcaagcc aagaaagaat 301 ccgaagatca gaaacgacta aagcaagcca aagagctgga ccgagagagg gctgctgcca 361 atgagcagtt aaccagagcc atccTTCGGG AGAGGATATG TAGCGAGGAG GAACGCGCTA 421 AGGCAAAGCA CCTGGCTAGG CAGCTGGAAG AGAAAGACCG AGTGCTAAAG AAGCAGGATG 481 CATTCTACAA AGAACAGCTG GCTAGACTGG AGGAGAGGAG CTCAGAGTTC TACAGAGTCA 541 CCACTGAACA ATATCAGAAA GCTGCTGAAG AGGTGGAAGC AAAGTTCAAG CGATATGAGT 601 CTCATCCAGT CTGTGCTGAT CTGCAGGCCA AAATTCTTCA GTGTTACCGT GAGAACACCC 661 ACCAGACCCT CAAATGCTCC GCTCTGGCCA CCCAGTATAT GCACTGTGTC AATCATGCCA 721 AACAGAGCAT GCTTGAGAAG GGAGGATACC CAACTTTCTT GTACAAAGTG GTTGATATCG 781 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 841 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGAGAATA 901 TTCACCACGA AGATTGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 961 aagatt