Transcript: Human NM_001317178.1

Homo sapiens coiled-coil-helix-coiled-coil-helix domain containing 3 (CHCHD3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-26
Taxon:
Homo sapiens (human)
Gene:
CHCHD3 (54927)
Length:
1187
CDS:
222..638

Additional Resources:

NCBI RefSeq record:
NM_001317178.1
NBCI Gene record:
CHCHD3 (54927)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160043 CGAAGATCAGAAACGACTAAA pLKO.1 458 CDS 100% 13.200 18.480 N CHCHD3 n/a
2 TRCN0000278330 CGAAGATCAGAAACGACTAAA pLKO_005 458 CDS 100% 13.200 18.480 N CHCHD3 n/a
3 TRCN0000166698 CGGACGAGAATGAGAACATCA pLKO.1 262 CDS 100% 4.950 3.960 N CHCHD3 n/a
4 TRCN0000164772 CAGCGGTATTCTGGTGCTTAT pLKO.1 360 CDS 100% 10.800 7.560 N CHCHD3 n/a
5 TRCN0000160532 CCTCAGTTTCTGATGAAGAAT pLKO.1 385 CDS 100% 5.625 3.938 N CHCHD3 n/a
6 TRCN0000278385 CCTCAGTTTCTGATGAAGAAT pLKO_005 385 CDS 100% 5.625 3.938 N CHCHD3 n/a
7 TRCN0000164991 GCATTGGAGCAAGCCAAGAAA pLKO.1 432 CDS 100% 5.625 3.938 N CHCHD3 n/a
8 TRCN0000278329 GCATTGGAGCAAGCCAAGAAA pLKO_005 432 CDS 100% 5.625 3.938 N CHCHD3 n/a
9 TRCN0000166461 CGAATGAAGGAATCCTCTCCA pLKO.1 324 CDS 100% 2.640 1.848 N CHCHD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03484 pDONR223 100% 55.2% 55.4% None (many diffs) n/a
2 ccsbBroad304_03484 pLX_304 0% 55.2% 55.4% V5 (many diffs) n/a
3 TRCN0000479814 TGAGAATATTCACCACGAAGATTG pLX_317 53.2% 55.2% 55.4% V5 (many diffs) n/a
Download CSV